Transcript: Human NM_022479.3

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 17 (GALNT17), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GALNT17 (64409)
Length:
3909
CDS:
660..2456

Additional Resources:

NCBI RefSeq record:
NM_022479.3
NBCI Gene record:
GALNT17 (64409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156260 CTGGACCATGTTTACCCAGAA pLKO.1 2007 CDS 100% 4.050 5.670 N GALNT17 n/a
2 TRCN0000154585 GTCTCCGAAAGAAGAGCATTA pLKO.1 1950 CDS 100% 10.800 8.640 N GALNT17 n/a
3 TRCN0000154512 GCGGAAGAAGAAGCCATATAA pLKO.1 1799 CDS 100% 15.000 10.500 N GALNT17 n/a
4 TRCN0000155562 CAGGAAGTTCTTCGGTGAAAT pLKO.1 1658 CDS 100% 13.200 9.240 N GALNT17 n/a
5 TRCN0000155309 GCTGATGCTTTCTCTCCTAAT pLKO.1 3078 3UTR 100% 10.800 7.560 N GALNT17 n/a
6 TRCN0000156028 CCATGAGAAGTATGGCTACAA pLKO.1 1001 CDS 100% 4.950 3.465 N GALNT17 n/a
7 TRCN0000156318 CGAGGTTACTTCTACCCAGAT pLKO.1 2942 3UTR 100% 4.050 2.835 N GALNT17 n/a
8 TRCN0000157524 GCTTCGCAACAACAAGGCAAA pLKO.1 2063 CDS 100% 4.050 2.835 N GALNT17 n/a
9 TRCN0000155533 GCAATATTGTATCCGTGCCAT pLKO.1 2124 CDS 100% 2.640 1.848 N GALNT17 n/a
10 TRCN0000155928 CCAGAGACAGAAATAGGCTAA pLKO.1 3162 3UTR 100% 4.050 2.430 N GALNT17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08854 pDONR223 100% 99.9% 100% None 1566T>C n/a
2 ccsbBroad304_08854 pLX_304 0% 99.9% 100% V5 1566T>C n/a
3 TRCN0000477589 TCGAAATTATAATTCTGGCCCTCA pLX_317 28.2% 99.9% 100% V5 1566T>C n/a
Download CSV