Transcript: Human NM_022567.2

Homo sapiens nyctalopin (NYX), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
NYX (60506)
Length:
2629
CDS:
431..1876

Additional Resources:

NCBI RefSeq record:
NM_022567.2
NBCI Gene record:
NYX (60506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425244 CCCATTACACCGAAGTCCTTT pLKO_005 2283 3UTR 100% 4.950 3.960 N NYX n/a
2 TRCN0000083321 CCCTGGTTTCTCCTCGCCTCT pLKO.1 1802 CDS 100% 0.000 0.000 N NYX n/a
3 TRCN0000083318 CCTAGCCACAAAGGAACTTTA pLKO.1 2506 3UTR 100% 13.200 9.240 N NYX n/a
4 TRCN0000446194 GCCTGCAAGGCCTGAATTAGA pLKO_005 2207 3UTR 100% 5.625 3.938 N NYX n/a
5 TRCN0000083322 GCATCTGCTGCTCAACGACAA pLKO.1 1129 CDS 100% 4.050 2.835 N NYX n/a
6 TRCN0000083320 GCCGCCTAGACCTAGCAGCCT pLKO.1 843 CDS 100% 0.000 0.000 N NYX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03892 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03892 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468575 GCGTCTTTTTCTTATGCCGTTGCA pLX_317 21.2% 100% 100% V5 n/a
Download CSV