Transcript: Human NM_022892.1

Homo sapiens NLR family apoptosis inhibitory protein (NAIP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NAIP (4671)
Length:
5880
CDS:
534..4259

Additional Resources:

NCBI RefSeq record:
NM_022892.1
NBCI Gene record:
NAIP (4671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430492 ACGACTACCAAGGCTCATTAG pLKO_005 4100 CDS 100% 10.800 15.120 N NAIP n/a
2 TRCN0000417867 ATCCTCAATCTAAGTACTTAA pLKO_005 4189 CDS 100% 13.200 10.560 N NAIP n/a
3 TRCN0000063733 GCCGTGGTGAACTTTGTGAAT pLKO.1 1126 CDS 100% 4.950 3.960 N NAIP n/a
4 TRCN0000063735 CCAGAGACTAAGACCATTCTA pLKO.1 2246 CDS 100% 5.625 3.938 N NAIP n/a
5 TRCN0000063737 GCTTTCAATCAATCACAAGAT pLKO.1 3941 CDS 100% 4.950 3.465 N NAIP n/a
6 TRCN0000063736 GCAGTTAAAGAATCAGGTCTT pLKO.1 1667 CDS 100% 4.050 2.835 N NAIP n/a
7 TRCN0000412891 GAATGAATGGGAGCGAAATTT pLKO_005 2918 CDS 100% 15.000 7.500 Y NAIP n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5258 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5258 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000063734 GCTGAGTATGATCCTTCCAAA pLKO.1 3465 CDS 100% 4.950 2.475 Y NAIP n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5256 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5256 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5256 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.