Transcript: Human NM_022901.3

Homo sapiens leucine rich repeat containing 19 (LRRC19), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
LRRC19 (64922)
Length:
3588
CDS:
91..1203

Additional Resources:

NCBI RefSeq record:
NM_022901.3
NBCI Gene record:
LRRC19 (64922)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133642 GTAATTCAACAGGGTGCATTT pLKO.1 421 CDS 100% 10.800 15.120 N LRRC19 n/a
2 TRCN0000136795 CAGCCCATCAGCAATTCAATA pLKO.1 817 CDS 100% 13.200 9.240 N LRRC19 n/a
3 TRCN0000134717 GAACTGGTTGAACACATCAAA pLKO.1 654 CDS 100% 5.625 3.938 N LRRC19 n/a
4 TRCN0000135066 CACCACTATTTCATCTGGAAT pLKO.1 578 CDS 100% 4.950 3.465 N LRRC19 n/a
5 TRCN0000136999 CCAGAGAGACATTCACAAGTA pLKO.1 2063 3UTR 100% 4.950 3.465 N LRRC19 n/a
6 TRCN0000134716 GCCTGGCTAATTTCTGTATTT pLKO.1 2327 3UTR 100% 13.200 6.600 Y LRRC19 n/a
7 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2354 3UTR 100% 4.950 2.475 Y n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2425 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2425 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03983 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03983 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477333 CACACCGGTGGTTGGACAAGGACC pLX_317 39.9% 100% 100% V5 n/a
Download CSV