Transcript: Human NM_022916.6

Homo sapiens VPS33A core subunit of CORVET and HOPS complexes (VPS33A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
VPS33A (65082)
Length:
4559
CDS:
87..1877

Additional Resources:

NCBI RefSeq record:
NM_022916.6
NBCI Gene record:
VPS33A (65082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022916.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151106 GCACATATTGACCTTACACAA pLKO.1 1403 CDS 100% 4.950 6.930 N VPS33A n/a
2 TRCN0000156176 CGAGATAAGAACTTCAACGCA pLKO.1 984 CDS 100% 0.750 1.050 N VPS33A n/a
3 TRCN0000158349 CGGCAGCTGATGTGAAGAATA pLKO.1 301 CDS 100% 13.200 9.240 N VPS33A n/a
4 TRCN0000156607 GCAGGAAGCAAGGCAATAGTT pLKO.1 177 CDS 100% 5.625 3.938 N VPS33A n/a
5 TRCN0000157738 CCAGGCTAGAGTTGATGGATA pLKO.1 340 CDS 100% 4.950 3.465 N VPS33A n/a
6 TRCN0000155401 CGAGGAAAGACACAATGCTAA pLKO.1 1052 CDS 100% 4.950 3.465 N VPS33A n/a
7 TRCN0000152312 CCATAGAAGAAACATGGGAAT pLKO.1 1956 3UTR 100% 4.050 2.835 N VPS33A n/a
8 TRCN0000157062 GCCATGGTGTTTCACCATGTT pLKO.1 2233 3UTR 100% 0.495 0.347 N VPS33A n/a
9 TRCN0000155768 CCCATAGAAGAAACATGGGAA pLKO.1 1955 3UTR 100% 0.264 0.185 N VPS33A n/a
10 TRCN0000152251 CCTAATCTGCTGAAGAAAGAA pLKO.1 2349 3UTR 100% 5.625 3.375 N VPS33A n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3782 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3782 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022916.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466165 CAGGCGTCCACGCTTTTATACCAT pLX_317 21.1% 99.9% 100% V5 12T>C n/a
2 ccsbBroadEn_08890 pDONR223 100% 99.8% 99.8% None 12T>C;1782A>C n/a
3 ccsbBroad304_08890 pLX_304 0% 99.8% 99.8% V5 12T>C;1782A>C n/a
Download CSV