Construct: ORF TRCN0000466165
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005674.1_s317c1
- Derived from:
- ccsbBroadEn_08890
- DNA Barcode:
- CAGGCGTCCACGCTTTTATACCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VPS33A (65082)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466165
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 65082 | VPS33A | VPS33A core subunit of CORV... | NM_022916.6 | 99.9% | 100% | 12T>C |
2 | human | 65082 | VPS33A | VPS33A core subunit of CORV... | NM_001351019.2 | 96.5% | 93.8% | (many diffs) |
3 | human | 65082 | VPS33A | VPS33A core subunit of CORV... | NM_001351018.2 | 96.3% | 94.9% | (many diffs) |
4 | human | 65082 | VPS33A | VPS33A core subunit of CORV... | NM_001351020.2 | 81.9% | 82% | 12T>C;774_775ins321 |
5 | human | 65082 | VPS33A | VPS33A core subunit of CORV... | NM_001351021.2 | 29.2% | 28% | (many diffs) |
6 | mouse | 77573 | Vps33a | VPS33A CORVET/HOPS core sub... | NM_029929.3 | 86.5% | 97.4% | (many diffs) |
7 | mouse | 77573 | Vps33a | VPS33A CORVET/HOPS core sub... | XM_006530503.3 | 80.5% | 90.3% | (many diffs) |
8 | mouse | 77573 | Vps33a | VPS33A CORVET/HOPS core sub... | XM_006530504.1 | 48.2% | 53.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1854
- ORF length:
- 1788
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggctcacctg tcctacggcc gagtgaacct aaacgtgttg cgcgaggcgg 121 tgcgtcgcga gctgcgcgag ttcctggaca agtgcgcagg aagcaaggca atagtttggg 181 atgaatacct aactggaccc tttggcctga ttgcacagta ttcactattg aaggaacatg 241 aagtggaaaa aatgttcaca cttaaaggaa atcgtttgcc ggcagctgat gtgaagaata 301 taattttttt tgtcagaccc aggctagagt tgatggatat aatcgctgaa aacgtgctca 361 gtgaagatag acgaggccca acgagagatt ttcatattct gtttgtgcca cgccgtagcc 421 tgttgtgcga acagcggttg aaggatctgg gtgtcttggg atcctttatt cacagggagg 481 agtacagctt agatctcatt ccattcgatg gggatctctt atccatggaa tcagagggtg 541 cattcaaaga gtgctacctg gagggtgacc agacgagcct gtaccacgca gccaaggggc 601 tgatgaccct gcaagctctg tatggaacga tcccccagat ctttgggaaa ggagaatgcg 661 ctcggcaagt ggccaatatg atgatcagga tgaagagaga gtttacagga agccagaatt 721 caatatttcc tgtttttgat aatctcttgt tgcttgatcg gaatgtggat ttattaacac 781 ctcttgccac tcagctgaca tatgaaggac tcattgatga aatttatggc attcagaaca 841 gttatgtgaa attacctcca gagaaatttg cacctaagaa acagggcgat ggtggtaagg 901 acctccccac ggaagcaaag aagctgcagc tgaattctgc agaggagctc tatgctgaga 961 tccgagataa gaacttcaac gcagttggct ctgtgctcag caagaaagca aagatcatct 1021 ctgcagcatt cgaggaaaga cacaatgcta agaccgtggg ggagatcaag cagtttgttt 1081 cccagttgcc ccacatgcag gcagcaaggg gctcgcttgc aaaccatacc tcaattgcag 1141 aattgatcaa agatgtcact acttctgaag acttttttga taaattaacc gtggaacagg 1201 agtttatgtc tggaatagac actgataagg tcaacaatta cattgaggat tgtatcgccc 1261 aaaagcactc gttgatcaag gtgttaagac tagtttgcct ccaatccgtg tgtaatagtg 1321 ggctcaaaca aaaagttttg gattattaca aaagagagat tctccagaca tacggctatg 1381 agcacatatt gaccttacac aacctggaga aggccggcct gctgaaaccg cagacggggg 1441 gcagaaacaa ttacccaact atacggaaaa cattacgcct ctGGATGGAT GATGTTAATG 1501 AGCAAAACCC CACGGACATA TCGTATGTGT ACAGTGGGTA TGCCCCGCTC AGTGTGCGGC 1561 TGGCCCAGCT GCTTTCCCGG CCTGGCTGGC GGAGCATCGA GGAGGTCCTC CGCATCCTCC 1621 CAGGGCCCCA CTTTGAGGAG CGGCAGCCAC TGCCCACAGG ACTGCAGAAG AAACGTCAAC 1681 CGGGAGAAAA CCGAGTGACT CTGATATTTT TCCTTGGGGG CGTAACCTTC GCTGAAATTG 1741 CTGCCCTGCG ATTTCTCTCC CAGTTGGAAG ATGGAGGTAC AGAATATGTC ATTGCCACCA 1801 CTAAACTAAT GAATGGAACC AGTTGGATAG AGGCTCTGAT GGAAAAACCT TTCTACCCAA 1861 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1921 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1981 TATCTTGTGG AAAGGACGAC AGGCGTCCAC GCTTTTATAC CATACGCGTT AAGTCgacaa 2041 tcaacctctg gattacaaaa tttgtgaaag att