Transcript: Human NM_023004.6

Homo sapiens reticulon 4 receptor (RTN4R), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RTN4R (65078)
Length:
1944
CDS:
227..1648

Additional Resources:

NCBI RefSeq record:
NM_023004.6
NBCI Gene record:
RTN4R (65078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023004.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240952 CAGCCAGGTGTGTGTACATAC pLKO_005 1677 3UTR 100% 10.800 15.120 N RTN4R n/a
2 TRCN0000240950 GTGCCTGCGTATGCTACAATG pLKO_005 312 CDS 100% 10.800 15.120 N RTN4R n/a
3 TRCN0000240954 ATCCTGTGGCTGCACTCGAAT pLKO_005 479 CDS 100% 4.950 6.930 N RTN4R n/a
4 TRCN0000370489 CAAACGCCTAGCTGCCAATGA pLKO_005 1120 CDS 100% 4.950 6.930 N RTN4R n/a
5 TRCN0000061558 CACATCAATGACTCACCCTTT pLKO.1 1358 CDS 100% 4.050 5.670 N RTN4R n/a
6 TRCN0000061562 CCGAATTGATGCGGCTGCCTT pLKO.1 508 CDS 100% 0.880 1.232 N RTN4R n/a
7 TRCN0000240953 AGCTGGACCTCAGCGATAATG pLKO_005 552 CDS 100% 13.200 9.240 N RTN4R n/a
8 TRCN0000061559 CTCTATCTGTTTGCCAACAAT pLKO.1 917 CDS 100% 5.625 3.938 N RTN4R n/a
9 TRCN0000300015 CTCTATCTGTTTGCCAACAAT pLKO_005 917 CDS 100% 5.625 3.938 N RTN4R n/a
10 TRCN0000370495 TGACAAGGCCTCAGTACTGGA pLKO_005 1249 CDS 100% 2.640 1.848 N RTN4R n/a
11 TRCN0000061561 CCGTCTCCTACTGCACCAGAA pLKO.1 841 CDS 100% 1.350 0.945 N RTN4R n/a
12 TRCN0000240951 GTACCTGAGGCTCAACGACAA pLKO_005 985 CDS 100% 0.000 0.000 N RTN4R n/a
13 TRCN0000071722 GCTACAATGAGCCCAAGGTAA pLKO.1 324 CDS 100% 4.950 3.465 N Rtn4r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023004.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03995 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03995 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470625 ATCGGGCATCATCTCAAAGATCCC pLX_317 31.9% 100% 100% V5 n/a
Download CSV