Transcript: Mouse NM_023048.5

Mus musculus ankyrin repeat and SOCS box-containing 4 (Asb4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Asb4 (65255)
Length:
3286
CDS:
31..1311

Additional Resources:

NCBI RefSeq record:
NM_023048.5
NBCI Gene record:
Asb4 (65255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023048.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092638 CCTGCTACTATTGGAGTAAAT pLKO.1 2169 3UTR 100% 13.200 18.480 N Asb4 n/a
2 TRCN0000092640 GCCAGAGGGAATCATTTACTA pLKO.1 1290 CDS 100% 5.625 7.875 N Asb4 n/a
3 TRCN0000092642 CGCTCGTGATGATGATTTCAA pLKO.1 768 CDS 100% 5.625 3.938 N Asb4 n/a
4 TRCN0000092639 GCTGCCAAATTAGTTAAGAAA pLKO.1 67 CDS 100% 5.625 3.938 N Asb4 n/a
5 TRCN0000092641 GCATCTTACAAACAAGGCTAT pLKO.1 202 CDS 100% 4.050 2.835 N Asb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023048.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03361 pDONR223 100% 70.1% 72% None (many diffs) n/a
2 ccsbBroad304_03361 pLX_304 0% 70.1% 72% V5 (many diffs) n/a
3 TRCN0000468196 TGGTTGACACCCCCACGCTGCTTC pLX_317 22% 70.1% 72% V5 (many diffs) n/a
Download CSV