Construct: ORF TRCN0000468196
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018294.1_s317c1
- Derived from:
- ccsbBroadEn_03361
- DNA Barcode:
- TGGTTGACACCCCCACGCTGCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ASB4 (51666)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468196
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51666 | ASB4 | ankyrin repeat and SOCS box... | NM_145872.2 | 100% | 100% | |
| 2 | human | 51666 | ASB4 | ankyrin repeat and SOCS box... | XM_017012303.1 | 91.8% | 89.6% | (many diffs) |
| 3 | human | 51666 | ASB4 | ankyrin repeat and SOCS box... | NM_016116.3 | 80.9% | 77.4% | (many diffs) |
| 4 | mouse | 65255 | Asb4 | ankyrin repeat and SOCS box... | NM_023048.5 | 70.1% | 72% | (many diffs) |
| 5 | mouse | 65255 | Asb4 | ankyrin repeat and SOCS box... | XM_017321708.1 | 70.1% | 72% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1116
- ORF length:
- 1047
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggacggcacc actgcccctg tcactaaatc tggagctgcc aagttagtta 121 agagaaattt ccttgaggcg ctaaagtcca atgacttcgg aaaattgaag gctattttga 181 tccaaaggca aatagatgtg gacactgttt ttgaagtcga agatgagaat atggttttgg 241 catcttataa acaaggttac tggttgccta gctataaatt gaagtcttcc tgggccacag 301 gcctccatct ctctgtcttg tttggccatg tggaatgtct tctggtgcta ctggaccaca 361 atgctacaat caactgtaga cccaatggga aaacccctct tcacgtggct tgtgaaatgg 421 ccaatgtgga ttgtgttaag atcctctgtg atcgtggggc aaagctcaat tgctactcct 481 taagtggaca cacagctttg cacttttgta caactccaag ttccattctc tgtgccaagc 541 aattggtttg gagaggggcg aatgtgaaca tgaagaccaa caaccaagat gaggagacgc 601 ccttgcacac ggctgcccac ttcggccttt cggagctggt ggccttctac gtggaacacg 661 gggccatagt ggacagcgtg aatgcccaca tggagacccc cctggccatc gccgcctact 721 gggccctccg ctttaaggag caggagtaca gcacggagca ccacctggtc tgccgcatgc 781 tgcttgacta caaagccgaa gtcaatgccc gagatgacga ctttaaatct cccctccaca 841 aggcagcctg gaactgtgac cacgtgctca tgcacatgat gctggaagct GGCGCCGAAG 901 CCAATCTCAT GGATATCAAC GGCTGTGCTG CCATCCAGTA CGTGCTGAAG GTCACCTCCG 961 TGCGCCCTGC TGCCCAGCCT GAGATCTGCT ACCAGCTCCT GTTGAACCAT GGGGCTGCCC 1021 GAATATACCC TCCACAGTTC CATAAGGTGA GGCTCTGCCC AGTGGTCAGC AGGTTGAGGA 1081 AGATTCAAAT GGCAGCCTTG TCTGAAATCT CCAAGTTGCC AACTTTCTTG TACAAAGTGG 1141 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1201 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1261 ATGGTTGACA CCCCCACGCT GCTTCACGCG TTAAGTCgac aatcaacctc tggattacaa 1321 aatttgtgaa agatt