Transcript: Mouse NM_023053.3

Mus musculus twisted gastrulation BMP signaling modulator 1 (Twsg1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Twsg1 (65960)
Length:
4071
CDS:
159..827

Additional Resources:

NCBI RefSeq record:
NM_023053.3
NBCI Gene record:
Twsg1 (65960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248498 ATGTGCAACCCTCGGAATTAC pLKO_005 381 CDS 100% 13.200 18.480 N Twsg1 n/a
2 TRCN0000248495 CCATGGGTGCATCCAAGTATC pLKO_005 715 CDS 100% 10.800 15.120 N Twsg1 n/a
3 TRCN0000248497 ACACGCCCTTCCTAGTAATAA pLKO_005 2187 3UTR 100% 15.000 12.000 N Twsg1 n/a
4 TRCN0000192453 CCATCCACCAGTGTAAGATAT pLKO.1 685 CDS 100% 13.200 9.240 N Twsg1 n/a
5 TRCN0000248494 CCTAGTCTCCTTCCTAGAAAC pLKO_005 551 CDS 100% 10.800 7.560 N Twsg1 n/a
6 TRCN0000248496 GTCCAGAGTGCATTGACTATG pLKO_005 769 CDS 100% 10.800 7.560 N Twsg1 n/a
7 TRCN0000143526 GATGTGAGCAAATGCCTCATT pLKO.1 255 CDS 100% 4.950 3.465 N TWSG1 n/a
8 TRCN0000201700 GTAACAAAGCACTCTGTGCCA pLKO.1 232 CDS 100% 0.660 0.462 N Twsg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08691 pDONR223 100% 84.3% 93.2% None (many diffs) n/a
2 ccsbBroad304_08691 pLX_304 0% 84.3% 93.2% V5 (many diffs) n/a
Download CSV