Transcript: Mouse NM_023142.2

Mus musculus actin related protein 2/3 complex, subunit 1B (Arpc1b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arpc1b (11867)
Length:
1555
CDS:
106..1224

Additional Resources:

NCBI RefSeq record:
NM_023142.2
NBCI Gene record:
Arpc1b (11867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090827 CAGGATCTTCTCTGCCTATAT pLKO.1 603 CDS 100% 13.200 9.240 N Arpc1b n/a
2 TRCN0000090772 CCGTCACCTTCATCACAGAAA pLKO.1 851 CDS 100% 4.950 3.465 N Gm5637 n/a
3 TRCN0000090825 CCTGGATTCACTGCACAAGAA pLKO.1 1065 CDS 100% 4.950 3.465 N Arpc1b n/a
4 TRCN0000090824 GCACAAGAACAGTGTCAGCCA pLKO.1 1077 CDS 100% 0.660 0.462 N Arpc1b n/a
5 TRCN0000090768 CTGCTGGGAGGGAGGGAAAGG pLKO.1 1258 3UTR 100% 0.000 0.000 N Gm5637 n/a
6 TRCN0000090769 CCGGGTCATTTCCATCTGTTA pLKO.1 456 CDS 100% 4.950 2.970 N Gm5637 n/a
7 TRCN0000090771 GCCTATATCAAGGAGGTGGAA pLKO.1 616 CDS 100% 2.640 1.584 N Gm5637 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02312 pDONR223 100% 88.7% 97.3% None (many diffs) n/a
2 ccsbBroad304_02312 pLX_304 0% 88.7% 97.3% V5 (many diffs) n/a
3 TRCN0000473738 CGAGTGATCCCACTACCCTTACCG pLX_317 39.7% 88.7% 97.3% V5 (many diffs) n/a
Download CSV