Transcript: Mouse NM_023232.3

Mus musculus diablo, IAP-binding mitochondrial protein (Diablo), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Diablo (66593)
Length:
1939
CDS:
45..758

Additional Resources:

NCBI RefSeq record:
NM_023232.3
NBCI Gene record:
Diablo (66593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012311 GTACCGACAATATACAAGTTT pLKO.1 377 CDS 100% 0.000 0.000 N Diablo n/a
2 TRCN0000278166 GTACCGACAATATACAAGTTT pLKO_005 377 CDS 100% 0.000 0.000 N Diablo n/a
3 TRCN0000004513 CCGACAATATACAAGTTTACT pLKO.1 380 CDS 100% 5.625 4.500 N DIABLO n/a
4 TRCN0000320554 CCGACAATATACAAGTTTACT pLKO_005 380 CDS 100% 5.625 4.500 N DIABLO n/a
5 TRCN0000012308 GCCCTTCTCTAACACGTACTT pLKO.1 1258 3UTR 100% 4.950 3.960 N Diablo n/a
6 TRCN0000278100 GCCCTTCTCTAACACGTACTT pLKO_005 1258 3UTR 100% 4.950 3.960 N Diablo n/a
7 TRCN0000012309 CGGTTCCTATTGCTCAGAAAT pLKO.1 205 CDS 100% 13.200 9.240 N Diablo n/a
8 TRCN0000278102 CGGTTCCTATTGCTCAGAAAT pLKO_005 205 CDS 100% 13.200 9.240 N Diablo n/a
9 TRCN0000012312 CCAGAGTTGAGATGACTTCAA pLKO.1 454 CDS 100% 4.950 3.465 N Diablo n/a
10 TRCN0000278168 CCAGAGTTGAGATGACTTCAA pLKO_005 454 CDS 100% 4.950 3.465 N Diablo n/a
11 TRCN0000012310 GCTGTGTCTTTGGTAACAGAT pLKO.1 267 CDS 100% 4.950 3.465 N Diablo n/a
12 TRCN0000278101 GCTGTGTCTTTGGTAACAGAT pLKO_005 267 CDS 100% 4.950 3.465 N Diablo n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03728 pDONR223 100% 84.1% 84.9% None (many diffs) n/a
2 ccsbBroad304_03728 pLX_304 75.3% 84.1% 84.9% V5 (many diffs) n/a
3 TRCN0000474122 TGTAAAGCACTTATAACTACAAGC pLX_317 66% 84.1% 84.9% V5 (many diffs) n/a
Download CSV