Transcript: Mouse NM_023260.1

Mus musculus mitochondrial ribosomal protein S34 (Mrps34), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mrps34 (79044)
Length:
899
CDS:
49..705

Additional Resources:

NCBI RefSeq record:
NM_023260.1
NBCI Gene record:
Mrps34 (79044)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375466 TCACTGCGTTCACTGCGAAAC pLKO_005 497 CDS 100% 6.000 8.400 N Mrps34 n/a
2 TRCN0000196225 GAGCAAGTCATGTACCACGAT pLKO.1 442 CDS 100% 2.640 3.696 N Mrps34 n/a
3 TRCN0000375465 TGAGGATACGGCTCGGGAAAT pLKO_005 420 CDS 100% 10.800 8.640 N Mrps34 n/a
4 TRCN0000338018 GAGAGGTCCTGTGAGTCATTT pLKO_005 721 3UTR 100% 13.200 9.240 N Mrps34 n/a
5 TRCN0000195930 CAAAGGGAAGAGTGAGGATAC pLKO.1 408 CDS 100% 6.000 4.200 N Mrps34 n/a
6 TRCN0000338017 CAAAGGGAAGAGTGAGGATAC pLKO_005 408 CDS 100% 6.000 4.200 N Mrps34 n/a
7 TRCN0000179620 GAAATCGAGCAAGTCATGTAC pLKO.1 436 CDS 100% 4.950 3.465 N Mrps34 n/a
8 TRCN0000179393 GACTTTCAAAGGGAAGAGTGA pLKO.1 402 CDS 100% 2.640 1.848 N Mrps34 n/a
9 TRCN0000184348 GCATCCTGACTTTCAAAGGGA pLKO.1 395 CDS 100% 0.750 0.525 N Mrps34 n/a
10 TRCN0000338085 GCATCCTGACTTTCAAAGGGA pLKO_005 395 CDS 100% 0.750 0.525 N Mrps34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04005 pDONR223 100% 83.4% 89.4% None (many diffs) n/a
2 TRCN0000466374 TAAGCGAGCACCTAGCTCAGCAGC pLX_317 63.3% 83.4% 89.4% V5 (many diffs) n/a
Download CSV