Transcript: Mouse NM_023277.4

Mus musculus junction adhesion molecule 3 (Jam3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Jam3 (83964)
Length:
1986
CDS:
56..988

Additional Resources:

NCBI RefSeq record:
NM_023277.4
NBCI Gene record:
Jam3 (83964)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023277.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336502 TGGAATTGTCTTGCATCATTA pLKO_005 201 CDS 100% 13.200 18.480 N Jam3 n/a
2 TRCN0000194327 CGTTGCTCTAAATGACCGAAA pLKO.1 406 CDS 100% 4.050 5.670 N Jam3 n/a
3 TRCN0000175509 CCCAAATCAGAAAGGTGAAAT pLKO.1 1511 3UTR 100% 13.200 9.240 N Jam3 n/a
4 TRCN0000336501 CCCAAATCAGAAAGGTGAAAT pLKO_005 1511 3UTR 100% 13.200 9.240 N Jam3 n/a
5 TRCN0000217666 GATTGGCCAGTACTGTCATTT pLKO.1 1448 3UTR 100% 13.200 9.240 N Jam3 n/a
6 TRCN0000194336 CAGGACATGGAAGTCTATGAT pLKO.1 752 CDS 100% 5.625 3.938 N Jam3 n/a
7 TRCN0000174339 CTTATTGTTCTTGCTGTGATT pLKO.1 812 CDS 100% 4.950 3.465 N Jam3 n/a
8 TRCN0000336442 CTTATTGTTCTTGCTGTGATT pLKO_005 812 CDS 100% 4.950 3.465 N Jam3 n/a
9 TRCN0000174595 GATGAGATTACCATTGAGTTA pLKO.1 434 CDS 100% 4.950 3.465 N Jam3 n/a
10 TRCN0000336441 GATGAGATTACCATTGAGTTA pLKO_005 434 CDS 100% 4.950 3.465 N Jam3 n/a
11 TRCN0000176198 GCCAAACCACATATGTGTATT pLKO.1 273 CDS 100% 0.000 0.000 N Jam3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023277.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04290 pDONR223 100% 85.7% 86.4% None (many diffs) n/a
2 ccsbBroad304_04290 pLX_304 0% 85.7% 86.4% V5 (many diffs) n/a
3 TRCN0000477899 TCTACCTTGATCAAGGCTTGGAAA pLX_317 52.2% 85.7% 86.4% V5 (many diffs) n/a
Download CSV