Transcript: Mouse NM_023485.3

Mus musculus syncoilin (Sync), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sync (68828)
Length:
2038
CDS:
119..1531

Additional Resources:

NCBI RefSeq record:
NM_023485.3
NBCI Gene record:
Sync (68828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023485.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262067 GAATGCGTGGCTTACCAATAC pLKO_005 839 CDS 100% 10.800 15.120 N Sync n/a
2 TRCN0000191961 GCTTTCCACATATAAGGCTAT pLKO.1 1429 CDS 100% 4.050 5.670 N Sync n/a
3 TRCN0000262066 GACGCCAGATGAGGTGCAAAT pLKO_005 451 CDS 100% 10.800 8.640 N Sync n/a
4 TRCN0000262069 AGCCAGCACTGACACTGTTTA pLKO_005 345 CDS 100% 13.200 9.240 N Sync n/a
5 TRCN0000262068 GAAGGAGGCCAAGACCTTTAA pLKO_005 217 CDS 100% 13.200 9.240 N Sync n/a
6 TRCN0000262065 TCCTCTTCAGGAGTCAGAATC pLKO_005 193 CDS 100% 10.800 7.560 N Sync n/a
7 TRCN0000192167 CGATGAAGAGGTTCAACAGTA pLKO.1 1294 CDS 100% 4.950 3.465 N Sync n/a
8 TRCN0000192880 GCAAGTTCAGCAACAGAAGAA pLKO.1 1369 CDS 100% 4.950 3.465 N Sync n/a
9 TRCN0000189741 GACTGTGAACCTAGAGGACAT pLKO.1 265 CDS 100% 4.050 2.835 N Sync n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023485.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12715 pDONR223 100% 27.7% 28.6% None (many diffs) n/a
2 ccsbBroad304_12715 pLX_304 0% 27.7% 28.6% V5 (many diffs) n/a
3 TRCN0000468318 GAAAACGACCACTGAGCGTGTTCA pLX_317 88.8% 27.7% 28.6% V5 (many diffs) n/a
Download CSV