Transcript: Mouse NM_023529.2

Mus musculus membrane-spanning 4-domains, subfamily A, member 10 (Ms4a10), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ms4a10 (69826)
Length:
1038
CDS:
75..878

Additional Resources:

NCBI RefSeq record:
NM_023529.2
NBCI Gene record:
Ms4a10 (69826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124623 CCCGGCAGTGTTACTGGAGAA pLKO.1 102 CDS 100% 1.350 1.080 N Ms4a10 n/a
2 TRCN0000124621 GACACACCTATGGAACTTAAA pLKO.1 696 CDS 100% 13.200 9.240 N Ms4a10 n/a
3 TRCN0000124620 CTACAGAAGTTGGGTGGCTTT pLKO.1 234 CDS 100% 4.050 2.835 N Ms4a10 n/a
4 TRCN0000124622 CGGCTTCTTTGTCATTGCCAA pLKO.1 476 CDS 100% 2.640 1.848 N Ms4a10 n/a
5 TRCN0000124619 AGTAGTCTAAGACTACTAGAC pLKO.1 874 CDS 100% 0.405 0.284 N Ms4a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.