Transcript: Mouse NM_023543.2

Mus musculus chimerin 2 (Chn2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Chn2 (69993)
Length:
2653
CDS:
87..1085

Additional Resources:

NCBI RefSeq record:
NM_023543.2
NBCI Gene record:
Chn2 (69993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313835 ATATGACACCTACTCCAAATT pLKO_005 773 CDS 100% 13.200 9.240 N Chn2 n/a
2 TRCN0000112401 CCAACATCTACCCAGACATAA pLKO.1 694 CDS 100% 13.200 9.240 N Chn2 n/a
3 TRCN0000317418 CCAACATCTACCCAGACATAA pLKO_005 694 CDS 100% 13.200 9.240 N Chn2 n/a
4 TRCN0000112402 GTGTTCAGATTGTGGGTTAAA pLKO.1 410 CDS 100% 13.200 9.240 N Chn2 n/a
5 TRCN0000317417 GTGTTCAGATTGTGGGTTAAA pLKO_005 410 CDS 100% 13.200 9.240 N Chn2 n/a
6 TRCN0000112404 CGTACACAAACAGTGCTCCAA pLKO.1 431 CDS 100% 2.640 1.848 N Chn2 n/a
7 TRCN0000112403 TGGACATATGTATTCGGGAAA pLKO.1 559 CDS 100% 0.000 0.000 N Chn2 n/a
8 TRCN0000317353 TGGACATATGTATTCGGGAAA pLKO_005 559 CDS 100% 0.000 0.000 N Chn2 n/a
9 TRCN0000112400 GCCTCGTATGTATGTCTGTTT pLKO.1 1273 3UTR 100% 4.950 2.970 N Chn2 n/a
10 TRCN0000317355 GCCTCGTATGTATGTCTGTTT pLKO_005 1273 3UTR 100% 4.950 2.970 N Chn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477804 GCCGCGAGTCAAACACCACACCAG pLX_317 34% 62.5% 57.5% V5 (many diffs) n/a
2 ccsbBroadEn_05996 pDONR223 100% 62.4% 57.5% None (many diffs) n/a
3 ccsbBroad304_05996 pLX_304 0% 62.4% 57.5% V5 (many diffs) n/a
Download CSV