Transcript: Mouse NM_023595.6

Mus musculus deoxyuridine triphosphatase (Dut), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Dut (110074)
Length:
2358
CDS:
234..722

Additional Resources:

NCBI RefSeq record:
NM_023595.6
NBCI Gene record:
Dut (110074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023595.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080604 CGGATTTCTTATCCAGACTTA pLKO.1 633 CDS 100% 4.950 6.930 N Dut n/a
2 TRCN0000295539 ACGTTCTGGCTTGGCTGTAAA pLKO_005 479 CDS 100% 13.200 10.560 N Dut n/a
3 TRCN0000295482 CCTATTCAGTGCCTATGATTA pLKO_005 374 CDS 100% 13.200 9.240 N Dut n/a
4 TRCN0000080603 GCTGGAAGTATCTCGCTGTTT pLKO.1 729 3UTR 100% 4.950 3.465 N Dut n/a
5 TRCN0000298410 GCTGGAAGTATCTCGCTGTTT pLKO_005 729 3UTR 100% 4.950 3.465 N Dut n/a
6 TRCN0000080606 CGAGGATTACAGAGGAAACGT pLKO.1 533 CDS 100% 3.000 2.100 N Dut n/a
7 TRCN0000288247 CGAGGATTACAGAGGAAACGT pLKO_005 533 CDS 100% 3.000 2.100 N Dut n/a
8 TRCN0000080605 CGTGCTGTTTAACTTTGGGAA pLKO.1 560 CDS 100% 2.640 1.848 N Dut n/a
9 TRCN0000080607 GCCATCGTGAAGACAGACATT pLKO.1 417 CDS 100% 4.950 2.970 N Dut n/a
10 TRCN0000288187 GCCATCGTGAAGACAGACATT pLKO_005 417 CDS 100% 4.950 2.970 N Dut n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023595.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00469 pDONR223 100% 81.5% 86.5% None (many diffs) n/a
2 ccsbBroad304_00469 pLX_304 0% 81.5% 86.5% V5 (many diffs) n/a
3 TRCN0000474179 GGTTCTGTGACTTCCATAACCATG pLX_317 87.6% 81.5% 86.5% V5 (many diffs) n/a
Download CSV