Transcript: Mouse NM_023623.2

Mus musculus cytochrome P450, family 2, subfamily d, polypeptide 40 (Cyp2d40), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Cyp2d40 (71754)
Length:
1129
CDS:
13..1029

Additional Resources:

NCBI RefSeq record:
NM_023623.2
NBCI Gene record:
Cyp2d40 (71754)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252865 ATTTCTCACCATGGTGGATAA pLKO_005 273 CDS 100% 10.800 7.560 N Cyp2d40 n/a
2 TRCN0000252861 GTGAAGATGTTCCCAATTGTC pLKO_005 205 CDS 100% 4.950 3.465 N Cyp2d40 n/a
3 TRCN0000252862 CATCCCAGGGTTGGCTGATAA pLKO_005 231 CDS 100% 13.200 7.920 N Cyp2d40 n/a
4 TRCN0000252863 TGGTTGTCCTTGACCTGTTTG pLKO_005 425 CDS 100% 10.800 6.480 N Cyp2d40 n/a
5 TRCN0000252864 GTGACCTGACTGATGCCTTTA pLKO_005 341 CDS 100% 10.800 5.400 Y Cyp2d40 n/a
6 TRCN0000193241 CCATATTCACAGTCATCTTCA pLKO.1 50 CDS 100% 4.950 2.475 Y Cyp2d12 n/a
7 TRCN0000126472 CCCTACACCAATGCTGTCATT pLKO.1 595 CDS 100% 4.950 2.475 Y Cyp2d9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.