Transcript: Mouse NM_023633.3

Mus musculus ribosomal oxygenase 1 (Riox1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Riox1 (71952)
Length:
2346
CDS:
85..1896

Additional Resources:

NCBI RefSeq record:
NM_023633.3
NBCI Gene record:
Riox1 (71952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023633.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376817 GGCAACCATGTTATATGATAA pLKO_005 1836 CDS 100% 13.200 18.480 N Riox1 n/a
2 TRCN0000375740 TTAAAGAGGTCGGGTTCTTAC pLKO_005 1957 3UTR 100% 10.800 15.120 N Riox1 n/a
3 TRCN0000375742 CCGAGACTTCATGGATTACAT pLKO_005 1335 CDS 100% 5.625 7.875 N Riox1 n/a
4 TRCN0000196090 GTCGGGTTCTTACCTTGCTAA pLKO.1 1965 3UTR 100% 4.950 6.930 N Riox1 n/a
5 TRCN0000184156 CTACGATGACATCGAGGCTTT pLKO.1 990 CDS 100% 4.050 5.670 N Riox1 n/a
6 TRCN0000180788 GCATCAGTATGGTTGTGCTTA pLKO.1 1986 3UTR 100% 4.950 3.960 N Riox1 n/a
7 TRCN0000375743 ACCTGGAGACCTGCTCTATTT pLKO_005 1146 CDS 100% 13.200 9.240 N Riox1 n/a
8 TRCN0000366803 ACACCTCTAGTTCCGAGTTAG pLKO_005 1876 CDS 100% 10.800 7.560 N Riox1 n/a
9 TRCN0000376816 TGTCCACCTACCAGCGCAATA pLKO_005 1229 CDS 100% 10.800 7.560 N Riox1 n/a
10 TRCN0000375741 TTCAGAGCACCAGCTTCATTC pLKO_005 2137 3UTR 100% 10.800 7.560 N Riox1 n/a
11 TRCN0000173069 CCCGAGACTTCATGGATTACA pLKO.1 1334 CDS 100% 5.625 3.938 N RIOX1 n/a
12 TRCN0000184446 GAGGAACCCAAGTGCTTAGAA pLKO.1 1708 CDS 100% 5.625 3.938 N Riox1 n/a
13 TRCN0000181167 CGAGTTTATCACCTAGAGGAA pLKO.1 1693 CDS 100% 2.640 1.848 N Riox1 n/a
14 TRCN0000180487 GCTTCATTCACCAAGCTGAAT pLKO.1 1175 CDS 100% 0.495 0.297 N Riox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023633.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.