Transcript: Mouse NM_023637.3

Mus musculus seryl-aminoacyl-tRNA synthetase 2 (Sars2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sars2 (71984)
Length:
1910
CDS:
49..1605

Additional Resources:

NCBI RefSeq record:
NM_023637.3
NBCI Gene record:
Sars2 (71984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076139 CCCATCCCAGATTTACAATAT pLKO.1 885 CDS 100% 13.200 18.480 N Sars2 n/a
2 TRCN0000433380 CATGTGCCTCTCCAGTACATC pLKO_005 1531 CDS 100% 4.950 3.960 N Sars2 n/a
3 TRCN0000076142 GCTTATCGCAAGTTCGACATT pLKO.1 1246 CDS 100% 4.950 3.960 N Sars2 n/a
4 TRCN0000232585 ACCTGGAAATTGGCGAGAAAC pLKO_005 662 CDS 100% 10.800 7.560 N SARS2 n/a
5 TRCN0000420945 AGTTCGCACACACGGTGAATG pLKO_005 1382 CDS 100% 10.800 7.560 N Sars2 n/a
6 TRCN0000045500 CACCTGGAAATTGGCGAGAAA pLKO.1 661 CDS 100% 4.950 3.465 N SARS2 n/a
7 TRCN0000222653 CCTTCCTGCTTATCGCAAGTT pLKO.1 1239 CDS 100% 4.950 3.465 N Sars2 n/a
8 TRCN0000076138 CCTGCCAGTGAATTATTGTCA pLKO.1 1733 3UTR 100% 3.000 2.100 N Sars2 n/a
9 TRCN0000076140 GCAAACCAAGACAGTGACCAA pLKO.1 412 CDS 100% 2.640 1.848 N Sars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08432 pDONR223 100% 85.3% 86.1% None (many diffs) n/a
2 ccsbBroad304_08432 pLX_304 0% 85.3% 86.1% V5 (many diffs) n/a
3 TRCN0000480581 GAAATGCCGATACTTTTCTCATGG pLX_317 19.6% 85.3% 86.1% V5 (many diffs) n/a
Download CSV