Transcript: Mouse NM_023663.6

Mus musculus receptor-interacting serine-threonine kinase 4 (Ripk4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ripk4 (72388)
Length:
3550
CDS:
47..2407

Additional Resources:

NCBI RefSeq record:
NM_023663.6
NBCI Gene record:
Ripk4 (72388)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023663.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360670 GCTAGTGGATGCCATCATATC pLKO_005 1279 CDS 100% 10.800 15.120 N Ripk4 n/a
2 TRCN0000022638 CGCTTGTTTGACACCAAACAT pLKO.1 638 CDS 100% 0.563 0.788 N Ripk4 n/a
3 TRCN0000360600 CATAGTGGGTTCTTAATATAT pLKO_005 2802 3UTR 100% 15.000 10.500 N Ripk4 n/a
4 TRCN0000360599 TTCTACCTGTGTACGGCATAT pLKO_005 288 CDS 100% 10.800 7.560 N Ripk4 n/a
5 TRCN0000360671 TTTGACCTCAGAGGGCTATAC pLKO_005 2047 CDS 100% 10.800 7.560 N Ripk4 n/a
6 TRCN0000022634 GCCCACTACCATGTCAAGATT pLKO.1 503 CDS 100% 5.625 3.938 N Ripk4 n/a
7 TRCN0000022636 CCGATACATTCTACCTGTGTA pLKO.1 280 CDS 100% 4.950 3.465 N Ripk4 n/a
8 TRCN0000022635 GCTACTGTCAAGCTGCTCATA pLKO.1 2102 CDS 100% 4.950 3.465 N Ripk4 n/a
9 TRCN0000022637 CCGAAGTTCCTCTGAATGCAA pLKO.1 1114 CDS 100% 3.000 2.100 N Ripk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023663.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489346 TCGCCCATACCGGCACTAACCCAT pLX_317 15.3% 84.8% 90.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV