Transcript: Mouse NM_023668.2

Mus musculus nudE neurodevelopment protein 1 like 1 (Ndel1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ndel1 (83431)
Length:
2387
CDS:
203..1240

Additional Resources:

NCBI RefSeq record:
NM_023668.2
NBCI Gene record:
Ndel1 (83431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285985 GTATGAAGTGGAGGCGTTAAA pLKO_005 421 CDS 100% 13.200 18.480 N Ndel1 n/a
2 TRCN0000277515 GTCTCAGTACAGAGGTTAAAG pLKO_005 695 CDS 100% 13.200 18.480 N Ndel1 n/a
3 TRCN0000197869 GCGATATCAATACTGGCTATT pLKO.1 1416 3UTR 100% 10.800 15.120 N Ndel1 n/a
4 TRCN0000178292 GCATCCCGCAAATCTTATGTT pLKO.1 1043 CDS 100% 5.625 7.875 N Ndel1 n/a
5 TRCN0000277514 GCATCCCGCAAATCTTATGTT pLKO_005 1043 CDS 100% 5.625 7.875 N Ndel1 n/a
6 TRCN0000277516 TTGCTGTGCTGATAGGATTTA pLKO_005 1570 3UTR 100% 13.200 10.560 N Ndel1 n/a
7 TRCN0000178263 GCGAGCAACTTTCTTCCATAA pLKO.1 1123 CDS 100% 10.800 8.640 N Ndel1 n/a
8 TRCN0000277513 GCGAGCAACTTTCTTCCATAA pLKO_005 1123 CDS 100% 10.800 8.640 N Ndel1 n/a
9 TRCN0000176500 CTTTCCTTGAAGTATAAGCAA pLKO.1 266 CDS 100% 3.000 2.100 N Ndel1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09072 pDONR223 100% 91.2% 95.6% None (many diffs) n/a
2 ccsbBroad304_09072 pLX_304 0% 91.2% 95.6% V5 (many diffs) n/a
3 TRCN0000492231 GGCGTTCTGCTTGCGCATATTTCC pLX_317 40.2% 91.2% 95.6% V5 (many diffs) n/a
Download CSV