Transcript: Human NM_023943.4

Homo sapiens transmembrane protein 108 (TMEM108), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
TMEM108 (66000)
Length:
3727
CDS:
211..1938

Additional Resources:

NCBI RefSeq record:
NM_023943.4
NBCI Gene record:
TMEM108 (66000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023943.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144178 CGATCAAGTATCTGAGATCTA pLKO.1 1917 CDS 100% 4.950 6.930 N TMEM108 n/a
2 TRCN0000121789 CCTTTGTGTAACCCTGACTTA pLKO.1 2019 3UTR 100% 4.950 3.960 N TMEM108 n/a
3 TRCN0000140832 GCATCACTTTGCCATTCCGTA pLKO.1 1948 3UTR 100% 2.640 2.112 N TMEM108 n/a
4 TRCN0000144114 CTTTGTGTAACCCTGACTTAA pLKO.1 2020 3UTR 100% 13.200 9.240 N TMEM108 n/a
5 TRCN0000140915 CAACCTGAGCTACTGGAACAA pLKO.1 1719 CDS 100% 4.950 3.465 N TMEM108 n/a
6 TRCN0000139079 CATTTGCCATCCAGGAACCAT pLKO.1 287 CDS 100% 3.000 2.100 N TMEM108 n/a
7 TRCN0000139581 CCAGACATACTTCTGTGGTGA pLKO.1 383 CDS 100% 2.640 1.848 N TMEM108 n/a
8 TRCN0000122109 CTTTCAGATCTACAAGGGCAA pLKO.1 858 CDS 100% 2.160 1.512 N TMEM108 n/a
9 TRCN0000144136 CTTCTGTCAAGAAACACTGTT pLKO.1 1887 CDS 100% 4.950 2.970 N TMEM108 n/a
10 TRCN0000142993 CCTTCTGTCAAGAAACACTGT pLKO.1 1886 CDS 100% 2.640 1.584 N TMEM108 n/a
11 TRCN0000140938 CTGGAACAACACCATCACCAT pLKO.1 1731 CDS 100% 2.640 1.584 N TMEM108 n/a
12 TRCN0000202353 GAACAACCTGAGCTACTGGAA pLKO.1 1716 CDS 100% 2.640 1.584 N Tmem108 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023943.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04008 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04008 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470192 ACCGACACCCACACTTTTCTGCCT pLX_317 18.2% 100% 100% V5 n/a
Download CSV