Transcript: Human NM_024014.4

Homo sapiens homeobox A6 (HOXA6), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HOXA6 (3203)
Length:
989
CDS:
26..727

Additional Resources:

NCBI RefSeq record:
NM_024014.4
NBCI Gene record:
HOXA6 (3203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024014.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017560 GACGTACACCTCACCTTGTTT pLKO.1 175 CDS 100% 5.625 7.875 N HOXA6 n/a
2 TRCN0000415237 CTCTACCAGGCTGGCTATGAC pLKO_005 104 CDS 100% 1.650 2.310 N HOXA6 n/a
3 TRCN0000017562 CGGAAGTACACGAGCCCGGTT pLKO.1 413 CDS 100% 0.000 0.000 N HOXA6 n/a
4 TRCN0000017559 GCCTCGTGTTTCTATTCTGAT pLKO.1 251 CDS 100% 4.950 3.960 N HOXA6 n/a
5 TRCN0000418154 GTTTCTACCAACAGTCCAACT pLKO_005 192 CDS 100% 4.050 2.835 N HOXA6 n/a
6 TRCN0000017561 CAAGCTCATCAATTCCACGCA pLKO.1 667 CDS 100% 0.660 0.462 N HOXA6 n/a
7 TRCN0000413913 TCACCGAGCGCCAGATCAAGA pLKO_005 606 CDS 100% 1.650 0.990 N Hoxa3 n/a
8 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 619 CDS 100% 4.050 2.025 Y Hoxa3 n/a
9 TRCN0000428431 CCAACAGTCCAACTCGGTCTT pLKO_005 199 CDS 100% 4.050 5.670 N Hoxa6 n/a
10 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 627 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024014.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00772 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00772 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480809 ATACACATAAGGATTATTCCCCCG pLX_317 49.5% 100% 100% V5 n/a
Download CSV