Transcript: Human NM_024015.5

Homo sapiens homeobox B4 (HOXB4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HOXB4 (3214)
Length:
2002
CDS:
32..787

Additional Resources:

NCBI RefSeq record:
NM_024015.5
NBCI Gene record:
HOXB4 (3214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024015.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432500 CCTCGACACCCGCTAACAAAT pLKO_005 1228 3UTR 100% 13.200 18.480 N HOXB4 n/a
2 TRCN0000015715 AGTTCACGTGAGCACGGTAAA pLKO.1 472 CDS 100% 10.800 15.120 N HOXB4 n/a
3 TRCN0000015713 CCCACACTTTATATACGAATA pLKO.1 909 3UTR 100% 10.800 15.120 N HOXB4 n/a
4 TRCN0000415041 GTTCACGTGAGCACGGTAAAC pLKO_005 473 CDS 100% 10.800 15.120 N Hoxb4 n/a
5 TRCN0000015717 CGATTACCTACCCAGCGACCA pLKO.1 109 CDS 100% 0.720 1.008 N HOXB4 n/a
6 TRCN0000015716 CCGTCCCACTCCGCGTGCAAA pLKO.1 422 CDS 100% 0.000 0.000 N HOXB4 n/a
7 TRCN0000417204 TGGATCCACGTTTCATCTTTA pLKO_005 1134 3UTR 100% 13.200 10.560 N HOXB4 n/a
8 TRCN0000015714 AGGAATATTCACAGAGCGATT pLKO.1 93 CDS 100% 4.050 2.835 N HOXB4 n/a
9 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 646 CDS 100% 4.050 2.025 Y Hoxa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024015.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.