Transcript: Mouse NM_024188.6

Mus musculus 3-oxoacid CoA transferase 1 (Oxct1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Oxct1 (67041)
Length:
3496
CDS:
345..1907

Additional Resources:

NCBI RefSeq record:
NM_024188.6
NBCI Gene record:
Oxct1 (67041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024188.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103142 GCGAAGGGAAATGCTCATAAA pLKO.1 1677 CDS 100% 13.200 18.480 N Oxct1 n/a
2 TRCN0000327112 GCGAAGGGAAATGCTCATAAA pLKO_005 1677 CDS 100% 13.200 18.480 N Oxct1 n/a
3 TRCN0000103140 GCAAGAAGTTTCGGCTAGTTT pLKO.1 2010 3UTR 100% 5.625 4.500 N Oxct1 n/a
4 TRCN0000327045 GCAAGAAGTTTCGGCTAGTTT pLKO_005 2010 3UTR 100% 5.625 4.500 N Oxct1 n/a
5 TRCN0000103141 CGCCTCATAAAGGGAGAGAAA pLKO.1 1146 CDS 100% 4.950 3.960 N Oxct1 n/a
6 TRCN0000103143 GCCTCATAAAGGGAGAGAAAT pLKO.1 1147 CDS 100% 13.200 9.240 N Oxct1 n/a
7 TRCN0000327121 GCCTCATAAAGGGAGAGAAAT pLKO_005 1147 CDS 100% 13.200 9.240 N Oxct1 n/a
8 TRCN0000103144 GCTTTACTGAAGACTGGAGTA pLKO.1 570 CDS 100% 4.050 2.835 N Oxct1 n/a
9 TRCN0000327047 GCTTTACTGAAGACTGGAGTA pLKO_005 570 CDS 100% 4.050 2.835 N Oxct1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024188.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01131 pDONR223 100% 86.6% 92.1% None (many diffs) n/a
2 ccsbBroad304_01131 pLX_304 0% 86.6% 92.1% V5 (many diffs) n/a
3 TRCN0000491810 CACACATTCGGAGTCTAGCATTGT pLX_317 23.9% 86.6% 92.1% V5 (many diffs) n/a
Download CSV