Transcript: Mouse NM_024225.5

Mus musculus sorting nexin 5 (Snx5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Snx5 (69178)
Length:
2419
CDS:
146..1360

Additional Resources:

NCBI RefSeq record:
NM_024225.5
NBCI Gene record:
Snx5 (69178)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024225.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305346 TGTTACTTGGACATAACTAAT pLKO_005 1526 3UTR 100% 13.200 18.480 N Snx5 n/a
2 TRCN0000305347 GGATTATGCTGGCCTTATTAT pLKO_005 394 CDS 100% 15.000 12.000 N Snx5 n/a
3 TRCN0000381718 TGCAGAGCTGCATCGACTTAT pLKO_005 1326 CDS 100% 13.200 10.560 N Snx5 n/a
4 TRCN0000311306 CATCGCTTCAGATCGACATAC pLKO_005 231 CDS 100% 10.800 8.640 N Snx5 n/a
5 TRCN0000380484 ACAAGCAAGAAGATCTCATAT pLKO_005 1833 3UTR 100% 13.200 9.240 N Snx5 n/a
6 TRCN0000380414 TCACTTGCACTTAAATCATTA pLKO_005 1399 3UTR 100% 13.200 9.240 N Snx5 n/a
7 TRCN0000093394 CCCTCTTGTAACCTTTACTAA pLKO.1 2087 3UTR 100% 5.625 3.938 N Snx5 n/a
8 TRCN0000093397 CGATACTACATGCTCAACATA pLKO.1 1031 CDS 100% 5.625 3.938 N Snx5 n/a
9 TRCN0000093398 GCCCTAATTGACTATGAGAAT pLKO.1 1088 CDS 100% 4.950 3.465 N Snx5 n/a
10 TRCN0000309598 GCCCTAATTGACTATGAGAAT pLKO_005 1088 CDS 100% 4.950 3.465 N Snx5 n/a
11 TRCN0000093396 GCTGAGTATCTCGCTGTCTTT pLKO.1 533 CDS 100% 4.950 3.465 N Snx5 n/a
12 TRCN0000331974 GCTGAGTATCTCGCTGTCTTT pLKO_005 533 CDS 100% 4.950 3.465 N Snx5 n/a
13 TRCN0000093395 GCTCCTACAAAGCCAGACTTT pLKO.1 422 CDS 100% 4.950 2.970 N Snx5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024225.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.