Transcript: Mouse NM_024254.3

Mus musculus katanin p80 subunit B like 1 (Katnbl1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Katnbl1 (72425)
Length:
2883
CDS:
162..1061

Additional Resources:

NCBI RefSeq record:
NM_024254.3
NBCI Gene record:
Katnbl1 (72425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264497 AGTGAACTTGTAGCTTATTTA pLKO_005 678 CDS 100% 15.000 21.000 N Katnbl1 n/a
2 TRCN0000264495 AGTCGGACATTTGTCATTAAT pLKO_005 498 CDS 100% 15.000 12.000 N Katnbl1 n/a
3 TRCN0000183369 GTCGGACATTTGTCATTAATA pLKO.1 499 CDS 100% 15.000 12.000 N Katnbl1 n/a
4 TRCN0000215335 CGGAACTTCTCTAATAGTATT pLKO.1 192 CDS 100% 13.200 10.560 N Katnbl1 n/a
5 TRCN0000159599 GTTCCAGGATATACTGGTAAT pLKO.1 999 CDS 100% 10.800 8.640 N KATNBL1 n/a
6 TRCN0000264496 CCAGGATATACTGGTAATATA pLKO_005 1002 CDS 100% 15.000 10.500 N Katnbl1 n/a
7 TRCN0000338793 CCAGGATATACTGGTAATATA pLKO_005 1002 CDS 100% 15.000 10.500 N KATNBL1 n/a
8 TRCN0000283069 GTCCATGGAGTTGGCTAATTT pLKO_005 1871 3UTR 100% 15.000 10.500 N Katnbl1 n/a
9 TRCN0000264498 TAAGGATGTAGATGCTTATTT pLKO_005 1025 CDS 100% 15.000 10.500 N Katnbl1 n/a
10 TRCN0000183523 GCTAATTTCTTCTGTTGGAAA pLKO.1 1494 3UTR 100% 4.950 3.465 N Katnbl1 n/a
11 TRCN0000195786 CCAGGTTCTATTCAGCAGGAA pLKO.1 611 CDS 100% 2.640 1.848 N Katnbl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04123 pDONR223 100% 87.3% 86.1% None (many diffs) n/a
Download CSV