Transcript: Human NM_024416.4

Homo sapiens osteoglycin (OGN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
OGN (4969)
Length:
3455
CDS:
25..1095

Additional Resources:

NCBI RefSeq record:
NM_024416.4
NBCI Gene record:
OGN (4969)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373157 ACCTCTATTGGTACAACATAT pLKO_005 1095 CDS 100% 13.200 18.480 N OGN n/a
2 TRCN0000373155 TGATGTAAGTACGAGGATAAA pLKO_005 1410 3UTR 100% 13.200 18.480 N OGN n/a
3 TRCN0000148282 CCTAACTTAAGAAGACTCGAT pLKO.1 625 CDS 100% 2.640 3.696 N OGN n/a
4 TRCN0000373156 GGAATCCGTGCCTCTTAATTT pLKO_005 873 CDS 100% 15.000 10.500 N OGN n/a
5 TRCN0000146972 CCAGAAAGTCTACGTGTAATT pLKO.1 895 CDS 100% 13.200 9.240 N OGN n/a
6 TRCN0000147605 GCCCAAATTTGAGATGCATTA pLKO.1 1376 3UTR 100% 10.800 7.560 N OGN n/a
7 TRCN0000146971 CAAAGGAATCAGCCTATCTTT pLKO.1 551 CDS 100% 5.625 3.938 N OGN n/a
8 TRCN0000148137 GCTTCAATTACAGATGACACA pLKO.1 937 CDS 100% 2.640 1.848 N OGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01116 pDONR223 100% 83.4% 83.1% None 1_174del;176_177delCAinsTG;179C>A n/a
2 ccsbBroad304_01116 pLX_304 0% 83.4% 83.1% V5 1_174del;176_177delCAinsTG;179C>A n/a
3 TRCN0000473686 ATCTCCGAATAAGACCCTTATAAC pLX_317 57.6% 83.4% 83.1% V5 1_174del;176_177delCAinsTG;179C>A n/a
Download CSV