Transcript: Human NM_024581.6

Homo sapiens family with sequence similarity 184 member A (FAM184A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
FAM184A (79632)
Length:
4128
CDS:
366..3788

Additional Resources:

NCBI RefSeq record:
NM_024581.6
NBCI Gene record:
FAM184A (79632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024581.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128490 GAAGGACTTATTGCTAGTCTT pLKO.1 2073 CDS 100% 4.950 6.930 N FAM184A n/a
2 TRCN0000148061 GCTAGTCATATTGGAATGCTT pLKO.1 1512 CDS 100% 3.000 4.200 N FAM184A n/a
3 TRCN0000149645 GCCGCTTTACAAGTGTCATTA pLKO.1 3264 CDS 100% 13.200 10.560 N FAM184A n/a
4 TRCN0000146790 CAGTTGAAAGATCGAGAGAAA pLKO.1 2382 CDS 100% 4.950 3.960 N FAM184A n/a
5 TRCN0000147450 GCTAGACCTTAGAAGAAAGAT pLKO.1 668 CDS 100% 5.625 3.938 N FAM184A n/a
6 TRCN0000148861 CACAGCTCTGTATAGACTGTT pLKO.1 3803 3UTR 100% 4.950 3.465 N FAM184A n/a
7 TRCN0000128652 CCTATGTCAAACACTGTGAAT pLKO.1 3868 3UTR 100% 4.950 3.465 N FAM184A n/a
8 TRCN0000130841 GCCCTATTAAGCAAGCACAAA pLKO.1 1422 CDS 100% 4.950 3.465 N FAM184A n/a
9 TRCN0000131110 GCAACTCAAATGACCCAGGAA pLKO.1 1536 CDS 100% 2.640 1.848 N FAM184A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024581.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12577 pDONR223 100% 96.5% 96.4% None 1_117del;130A>T;587G>A n/a
2 ccsbBroad304_12577 pLX_304 0% 96.5% 96.4% V5 1_117del;130A>T;587G>A n/a
3 TRCN0000481543 AGACAATGCAAGACCGGAAAGCGG pLX_317 12.4% 96.5% 96.4% V5 1_117del;130A>T;587G>A n/a
Download CSV