Transcript: Human NM_024642.5

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 12 (GALNT12), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GALNT12 (79695)
Length:
2764
CDS:
30..1775

Additional Resources:

NCBI RefSeq record:
NM_024642.5
NBCI Gene record:
GALNT12 (79695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024642.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035260 CGGACAGTTTACAGTGTCCTT pLKO.1 489 CDS 100% 0.264 0.211 N GALNT12 n/a
2 TRCN0000291739 CGGACAGTTTACAGTGTCCTT pLKO_005 489 CDS 100% 0.264 0.211 N GALNT12 n/a
3 TRCN0000303347 GACTACTGCTTTGACTATAAC pLKO_005 1395 CDS 100% 13.200 9.240 N GALNT12 n/a
4 TRCN0000303348 AGGTTCAAGCAACGTACTTTG pLKO_005 2183 3UTR 100% 10.800 7.560 N GALNT12 n/a
5 TRCN0000035259 CCCAGAAAGAAATACGCTATA pLKO.1 1504 CDS 100% 10.800 7.560 N GALNT12 n/a
6 TRCN0000035262 GCTGCACCAGATTAACATCTA pLKO.1 326 CDS 100% 4.950 3.465 N GALNT12 n/a
7 TRCN0000291676 GCTGCACCAGATTAACATCTA pLKO_005 326 CDS 100% 4.950 3.465 N GALNT12 n/a
8 TRCN0000035263 GAAGCAGGAATGGATACCCTT pLKO.1 1557 CDS 100% 2.640 1.848 N GALNT12 n/a
9 TRCN0000035261 CCCAGGACATCTGTTATCATA pLKO.1 435 CDS 100% 5.625 3.375 N GALNT12 n/a
10 TRCN0000291678 CCCAGGACATCTGTTATCATA pLKO_005 435 CDS 100% 5.625 3.375 N GALNT12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024642.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12596 pDONR223 100% 46.7% 46.8% None 1_927del;1497C>T;1707G>C n/a
2 ccsbBroad304_12596 pLX_304 0% 46.7% 46.8% V5 1_927del;1497C>T;1707G>C n/a
3 TRCN0000473170 CGGGGACGGCGCTGCTCCGGTGAA pLX_317 50.1% 46.7% 46.8% V5 1_927del;1497C>T;1707G>C n/a
Download CSV