Transcript: Human NM_024667.3

Homo sapiens VPS37B subunit of ESCRT-I (VPS37B), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
VPS37B (79720)
Length:
2706
CDS:
63..920

Additional Resources:

NCBI RefSeq record:
NM_024667.3
NBCI Gene record:
VPS37B (79720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140011 GCCGATGAAGTGGATGCAATT pLKO.1 1782 3UTR 100% 10.800 8.640 N VPS37B n/a
2 TRCN0000380091 AGCATGGTTCATGATACTTAT pLKO_005 1272 3UTR 100% 13.200 9.240 N VPS37B n/a
3 TRCN0000122091 CAGAATGTTCAGCTTAACAAA pLKO.1 177 CDS 100% 5.625 3.938 N VPS37B n/a
4 TRCN0000144349 CCTGAAGGTTTCTATGAAGAA pLKO.1 1631 3UTR 100% 4.950 3.465 N VPS37B n/a
5 TRCN0000140578 GAGACCCTGTTAGCACTTCTT pLKO.1 372 CDS 100% 4.950 3.465 N VPS37B n/a
6 TRCN0000141850 GATTGAGGAAGACACTGAGAA pLKO.1 410 CDS 100% 4.950 3.465 N VPS37B n/a
7 TRCN0000139237 CCAGGTTCTCTTTGAAGCCTA pLKO.1 302 CDS 100% 2.640 1.848 N VPS37B n/a
8 TRCN0000145312 CCTATCAGATAAAGAAGACCA pLKO.1 319 CDS 100% 2.640 1.848 N VPS37B n/a
9 TRCN0000141747 GAGACACAGAATGTTCAGCTT pLKO.1 171 CDS 100% 2.640 1.848 N VPS37B n/a
10 TRCN0000140271 GCAGATCGAAATGCCGATGAA pLKO.1 1770 3UTR 100% 4.950 2.970 N VPS37B n/a
11 TRCN0000140411 GAAGACACTGAGAACATGGCA pLKO.1 417 CDS 100% 0.750 0.450 N VPS37B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04113 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04113 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467771 ATTGCGTGCCCTTACATCGGAGCG pLX_317 2.1% 100% 100% V5 n/a
Download CSV