Construct: ORF TRCN0000467771
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016060.1_s317c1
- Derived from:
- ccsbBroadEn_04113
- DNA Barcode:
- ATTGCGTGCCCTTACATCGGAGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VPS37B (79720)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467771
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79720 | VPS37B | VPS37B subunit of ESCRT-I | NM_024667.3 | 100% | 100% | |
| 2 | human | 79720 | VPS37B | VPS37B subunit of ESCRT-I | XM_011538745.2 | 91.1% | 85% | (many diffs) |
| 3 | human | 79720 | VPS37B | VPS37B subunit of ESCRT-I | XM_005253622.3 | 88.4% | 85.5% | (many diffs) |
| 4 | human | 79720 | VPS37B | VPS37B subunit of ESCRT-I | XM_006719602.4 | 88.4% | 85.5% | (many diffs) |
| 5 | human | 79720 | VPS37B | VPS37B subunit of ESCRT-I | XM_011538743.2 | 82.8% | 82.8% | 111_287del |
| 6 | human | 79720 | VPS37B | VPS37B subunit of ESCRT-I | XM_017019970.1 | 30.5% | 28.4% | 111_287del;458_459insAGAC;492_493ins536 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 921
- ORF length:
- 855
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gggcgccggg agcgaagccc ggttcgccgg gctgtcgctg gtgcagctca 121 acgagctgct ggaggacgag ggccagctga cggagatggt gcagaagatg gaggagacac 181 agaatgttca gcttaacaaa gaaatgacac ttgccagcaa ccggagcctg gcagaaggaa 241 accttttgta ccagccccag ctggacacgt tgaaagcacg cttgacccag aaataccagg 301 aactccaggt tctctttgaa gcctatcaga taaagaagac caaattagac agacagtcta 361 gcagtgcttc cttggagacc ctgttagcac ttcttcaggc agaaggggcc aagattgagg 421 aagacactga gaacatggca gagaagtttc tggatggaga acttcctctg gattccttca 481 ttgatgtcta tcagagcaaa cggaaactgg cccacatgcg acgggtgaaa atcgagaagc 541 tccaggagat ggtcctaaag gggcagagac tcccacaggc cctggccccg ctgcccccca 601 ggctgcccga actggcacct accgcccccc ttccctaccc tgccccagag gccagtgggc 661 ctcctgccgt tgcacctcgg cgcatccccc ccccaccacc cccggtgcct gcgggacgct 721 tagccacccc gtttactgcg gccatgagtt cgggacaggc cgtgccgtac ccaggattac 781 agtgcccgcc cctgcccccc cgcgtgggcc tccccactca gcaaggattc tcttcgcagt 841 tcgtgtcccc atatccgcca cctctccctc agagaccccc gccccggctc cctccacacc 901 agccgggttt caTCCTCCAG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAATTG CGTGCCCTTA 1081 CATCGGAGCG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt