Transcript: Human NM_024736.7

Homo sapiens gasdermin D (GSDMD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
GSDMD (79792)
Length:
1723
CDS:
111..1565

Additional Resources:

NCBI RefSeq record:
NM_024736.7
NBCI Gene record:
GSDMD (79792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024736.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180013 CCTTCTCTTCCCGGATAAGAA pLKO.1 797 CDS 100% 5.625 7.875 N GSDMD n/a
2 TRCN0000180883 GAATGTGTACTCGCTGAGTGT pLKO.1 464 CDS 100% 2.640 3.696 N GSDMD n/a
3 TRCN0000179394 GTGTGTCAACCTGTCTATCAA pLKO.1 275 CDS 100% 5.625 3.938 N GSDMD n/a
4 TRCN0000179101 CAGCACCTCAATGAATGTGTA pLKO.1 452 CDS 100% 4.950 3.465 N GSDMD n/a
5 TRCN0000438254 GATGAGGTGCCTCCACAACTT pLKO_005 905 CDS 100% 4.950 3.465 N GSDMD n/a
6 TRCN0000178784 CAACCTGTCTATCAAGGACAT pLKO.1 281 CDS 100% 4.050 2.835 N GSDMD n/a
7 TRCN0000437302 TACTGCCTGGTGGTTAGGAAG pLKO_005 219 CDS 100% 4.050 2.835 N GSDMD n/a
8 TRCN0000434253 TGGTTATTGACTCTGACTTGG pLKO_005 772 CDS 100% 4.050 2.835 N GSDMD n/a
9 TRCN0000442600 ACTGAAGACTTCCAGGGCCTA pLKO_005 960 CDS 100% 2.160 1.512 N GSDMD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024736.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08961 pDONR223 100% 99.9% 100% None 492G>A n/a
2 ccsbBroad304_08961 pLX_304 0% 99.9% 100% V5 492G>A n/a
3 TRCN0000480470 CTACTGAGCTGATTTAACATGCGA pLX_317 19.3% 99.9% 100% V5 492G>A n/a
Download CSV