Transcript: Human NM_024769.5

Homo sapiens CXADR like membrane protein (CLMP), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CLMP (79827)
Length:
5032
CDS:
309..1430

Additional Resources:

NCBI RefSeq record:
NM_024769.5
NBCI Gene record:
CLMP (79827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024769.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350026 GAATGGCTGCTCACCGATAAT pLKO_005 456 CDS 100% 13.200 18.480 N Clmp n/a
2 TRCN0000135018 CTAATCCGAAGGAAAGACAAA pLKO.1 1071 CDS 100% 4.950 6.930 N CLMP n/a
3 TRCN0000137941 GCTCACCGATAATGAAGGGAA pLKO.1 464 CDS 100% 2.640 3.696 N CLMP n/a
4 TRCN0000137018 CCAGTCGTCATGTCTACAATA pLKO.1 508 CDS 100% 13.200 9.240 N CLMP n/a
5 TRCN0000134482 GAAGAAGAGAGACCTAATGAA pLKO.1 1104 CDS 100% 5.625 3.938 N CLMP n/a
6 TRCN0000134630 GTACACCTGTAAGGTTAAGAA pLKO.1 632 CDS 100% 5.625 3.938 N CLMP n/a
7 TRCN0000134441 GAACAGATTCAGATGAGCATT pLKO.1 1560 3UTR 100% 4.950 3.465 N CLMP n/a
8 TRCN0000138742 CCTTGCAGATTGAACCTCTGA pLKO.1 592 CDS 100% 2.640 1.848 N CLMP n/a
9 TRCN0000138223 CAGAAGGAAGTGACCTGACTT pLKO.1 739 CDS 100% 4.950 2.970 N CLMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024769.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04133 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04133 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481097 CCCGGCCGCTCGAGCCAGGATCTA pLX_317 46% 100% 100% V5 n/a
Download CSV