Transcript: Human NM_024812.3

Homo sapiens BAALC binder of MAP3K1 and KLF4 (BAALC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
BAALC (79870)
Length:
2817
CDS:
174..611

Additional Resources:

NCBI RefSeq record:
NM_024812.3
NBCI Gene record:
BAALC (79870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173072 CAACAGATGGACAGAAGTCGA pLKO.1 564 CDS 100% 2.640 2.112 N BAALC n/a
2 TRCN0000434724 ATCTTACCAGGTTCACTTAAA pLKO_005 1069 3UTR 100% 13.200 9.240 N BAALC n/a
3 TRCN0000173071 CTTCAGACCACAGAGGCTAAA pLKO.1 486 CDS 100% 10.800 7.560 N BAALC n/a
4 TRCN0000172456 CCTCTGACCCAGAAACAGAAT pLKO.1 462 CDS 100% 4.950 3.465 N BAALC n/a
5 TRCN0000167002 GTCACCATTAATGTAACAGAT pLKO.1 537 CDS 100% 4.950 3.465 N BAALC n/a
6 TRCN0000433660 CAAAGAACTGTGTCAACTAGC pLKO_005 592 CDS 100% 4.050 2.835 N BAALC n/a
7 TRCN0000173022 CCAGAGAAGAAGACGAACTGT pLKO.1 402 CDS 100% 3.000 2.100 N BAALC n/a
8 TRCN0000438000 AGAATCCACCTGGCTCACCTA pLKO_005 242 CDS 100% 2.640 1.848 N BAALC n/a
9 TRCN0000172784 GAGATGCTAAGAGAATGCCTG pLKO.1 508 CDS 100% 2.160 1.512 N BAALC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08976 pDONR223 100% 99.5% 99.3% None 12C>T;425A>C n/a
2 ccsbBroad304_08976 pLX_304 0% 99.5% 99.3% V5 12C>T;425A>C n/a
3 TRCN0000467984 GCACCTTAATTGCGAAAGGTTCAG pLX_317 76.9% 99.5% 99.3% V5 12C>T;425A>C n/a
Download CSV