Transcript: Human NM_024859.3

Homo sapiens MAGI family member, X-linked (MAGIX), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
MAGIX (79917)
Length:
2810
CDS:
48..1052

Additional Resources:

NCBI RefSeq record:
NM_024859.3
NBCI Gene record:
MAGIX (79917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419312 GGTCGATCCTGCTTGAGTAAT pLKO_005 1351 3UTR 100% 13.200 18.480 N MAGIX n/a
2 TRCN0000160608 CCAGGAGACTAATAATAGTAA pLKO.1 2436 3UTR 100% 5.625 7.875 N MAGIX n/a
3 TRCN0000417100 ATCCAGGGTAAGGCACGTAGT pLKO_005 366 CDS 100% 4.050 5.670 N MAGIX n/a
4 TRCN0000159460 CGATTTAATCAAGGCCTGATT pLKO.1 2626 3UTR 100% 0.495 0.693 N MAGIX n/a
5 TRCN0000435718 AGGGTCTCACACATAAATTAT pLKO_005 1517 3UTR 100% 15.000 10.500 N MAGIX n/a
6 TRCN0000166575 CCCAAGTCTGTCCTCTCAATT pLKO.1 2647 3UTR 100% 13.200 9.240 N MAGIX n/a
7 TRCN0000162045 CCTCTCAATTTCACCTGCATT pLKO.1 2658 3UTR 100% 4.950 3.465 N MAGIX n/a
8 TRCN0000166227 CATTTCTCTGTGGAGCTGGTT pLKO.1 414 CDS 100% 2.640 1.848 N MAGIX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12643 pDONR223 100% 61.9% 52.7% None (many diffs) n/a
2 ccsbBroad304_12643 pLX_304 0% 61.9% 52.7% V5 (many diffs) n/a
3 TRCN0000469222 AATTGCGGAGTACAACATACCCGC pLX_317 35.7% 61.9% 52.7% V5 (many diffs) n/a
Download CSV