Transcript: Human NM_024940.8

Homo sapiens dedicator of cytokinesis 5 (DOCK5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DOCK5 (80005)
Length:
10246
CDS:
221..5833

Additional Resources:

NCBI RefSeq record:
NM_024940.8
NBCI Gene record:
DOCK5 (80005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024940.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424755 AGTACCTTCCTAGCATAATTA pLKO_005 2673 CDS 100% 15.000 21.000 N DOCK5 n/a
2 TRCN0000434814 TATCAGTGAGAACTATCTAAT pLKO_005 979 CDS 100% 13.200 18.480 N DOCK5 n/a
3 TRCN0000113804 GCGACTAATAGCATTACAGAT pLKO.1 4990 CDS 100% 4.950 6.930 N DOCK5 n/a
4 TRCN0000432681 CCAAGCAAGGATAGCACTAAA pLKO_005 2051 CDS 100% 13.200 10.560 N DOCK5 n/a
5 TRCN0000113802 CGAGTGCTCTACTTGAGATTT pLKO.1 2531 CDS 100% 13.200 9.240 N DOCK5 n/a
6 TRCN0000113803 GCCACTCACTTCAGTCTTGAA pLKO.1 1351 CDS 100% 4.950 3.465 N DOCK5 n/a
7 TRCN0000113805 GCTGAGACTTACGAAAGCAAA pLKO.1 4193 CDS 100% 4.950 3.465 N DOCK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024940.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12656 pDONR223 100% 18.6% 18.7% None 891G>A;1050_5610delinsG n/a
2 ccsbBroad304_12656 pLX_304 0% 18.6% 18.7% V5 891G>A;1050_5610delinsG n/a
3 TRCN0000475033 TCGACCCATGTCGCACGTAAGCGC pLX_317 37.1% 18.6% 18.7% V5 891G>A;1050_5610delinsG n/a
Download CSV