Transcript: Human NM_025055.5

Homo sapiens coiled-coil domain containing 33 (CCDC33), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC33 (80125)
Length:
2750
CDS:
395..2662

Additional Resources:

NCBI RefSeq record:
NM_025055.5
NBCI Gene record:
CCDC33 (80125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025055.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243468 GAACCTGCCGGTTGAACTTTA pLKO_005 2215 CDS 100% 13.200 18.480 N CCDC33 n/a
2 TRCN0000243470 TCGAAAGAATGATCGAGAGAA pLKO_005 1936 CDS 100% 4.950 6.930 N CCDC33 n/a
3 TRCN0000243467 CCTCGAACTCCATCATCATAG pLKO_005 2505 CDS 100% 10.800 7.560 N CCDC33 n/a
4 TRCN0000172900 GCTGAGTGAGCTGGATATGAA pLKO.1 1873 CDS 100% 5.625 3.938 N CCDC33 n/a
5 TRCN0000243471 TGCTGAGTGAGCTGGATATGA pLKO_005 1872 CDS 100% 5.625 3.938 N CCDC33 n/a
6 TRCN0000168477 GCATTTGCAGAATGAGCTGAT pLKO.1 1915 CDS 100% 4.050 2.835 N CCDC33 n/a
7 TRCN0000172822 GAAAGCCAGTTAGAGGACTCA pLKO.1 2411 CDS 100% 2.640 1.848 N CCDC33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025055.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12671 pDONR223 100% 37.5% 28.6% None (many diffs) n/a
2 ccsbBroad304_12671 pLX_304 0% 37.5% 28.6% V5 (many diffs) n/a
3 TRCN0000466738 TGGATGTAAACCCACAATCCGGCG pLX_317 42% 37.5% 28.6% V5 (many diffs) n/a
Download CSV