Transcript: Human NM_025080.4

Homo sapiens asparaginase and isoaspartyl peptidase 1 (ASRGL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-24
Taxon:
Homo sapiens (human)
Gene:
ASRGL1 (80150)
Length:
2193
CDS:
139..1065

Additional Resources:

NCBI RefSeq record:
NM_025080.4
NBCI Gene record:
ASRGL1 (80150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025080.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433334 TGAGAGAAATGCCCGTATTAG pLKO_005 1237 3UTR 100% 13.200 18.480 N ASRGL1 n/a
2 TRCN0000437505 GCAAGCTGCACTTCGGAATTG pLKO_005 1010 CDS 100% 10.800 15.120 N ASRGL1 n/a
3 TRCN0000046902 GCTGGAGGTTATGCCGACAAT pLKO.1 751 CDS 100% 4.950 6.930 N ASRGL1 n/a
4 TRCN0000046901 GATACTACTATCACCGACCTT pLKO.1 1039 CDS 100% 2.640 3.696 N ASRGL1 n/a
5 TRCN0000046899 CGGACCTATCGTTGGGTTATA pLKO.1 881 CDS 100% 13.200 10.560 N ASRGL1 n/a
6 TRCN0000416405 AGCTGAGGTGAGCCATGATTA pLKO_005 1285 3UTR 100% 13.200 9.240 N ASRGL1 n/a
7 TRCN0000432323 GTTGAAATGGATGCTAGTATC pLKO_005 361 CDS 100% 10.800 7.560 N ASRGL1 n/a
8 TRCN0000046900 CGCAGTCCAGTGTATAGCAAA pLKO.1 417 CDS 100% 4.950 3.465 N ASRGL1 n/a
9 TRCN0000427115 GAACAAGGAAAGACGGTAGAA pLKO_005 853 CDS 100% 4.950 3.465 N ASRGL1 n/a
10 TRCN0000046898 CCCATTAAACTTGCTCGGCTT pLKO.1 439 CDS 100% 2.160 1.512 N ASRGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025080.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12673 pDONR223 100% 58.4% 58.4% None 1_384del n/a
2 ccsbBroad304_12673 pLX_304 0% 58.4% 58.4% V5 1_384del n/a
3 TRCN0000471127 GACCGAGCTCCGCCATCCGTGTAC pLX_317 70% 58.4% 58.4% V5 1_384del n/a
Download CSV