Transcript: Human NM_025098.4

Homo sapiens monoacylglycerol O-acyltransferase 2 (MOGAT2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MOGAT2 (80168)
Length:
2723
CDS:
52..1056

Additional Resources:

NCBI RefSeq record:
NM_025098.4
NBCI Gene record:
MOGAT2 (80168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025098.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005185 CCAGTACAGCTTTGGTTTAAT pLKO.1 852 CDS 100% 15.000 21.000 N MOGAT2 n/a
2 TRCN0000005186 CTGGACTATATGGAAGTACAT pLKO.1 279 CDS 100% 4.950 3.960 N MOGAT2 n/a
3 TRCN0000433465 TGGCTCCTGGTTACGCTATAT pLKO_005 768 CDS 100% 13.200 9.240 N MOGAT2 n/a
4 TRCN0000424314 GAAACTTGCTGGGCATCATTG pLKO_005 584 CDS 100% 10.800 7.560 N MOGAT2 n/a
5 TRCN0000005187 ACACTTGCTGTCCTACAGTTT pLKO.1 100 CDS 100% 4.950 3.465 N MOGAT2 n/a
6 TRCN0000424234 CACAGGCTTCTCTTCGATCTT pLKO_005 426 CDS 100% 4.950 3.465 N MOGAT2 n/a
7 TRCN0000005183 CCCTCCTGTTTACAAGATTCT pLKO.1 170 CDS 100% 4.950 3.465 N MOGAT2 n/a
8 TRCN0000005184 GAATGACCTATTTGACCAGAT pLKO.1 735 CDS 100% 4.050 2.430 N MOGAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025098.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04180 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04180 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481110 CGTTAGTCATTACCTCATCGTCAG pLX_317 40.8% 100% 100% V5 n/a
4 ccsbBroadEn_12677 pDONR223 100% 73% 69.5% None (many diffs) n/a
5 ccsbBroad304_12677 pLX_304 0% 73% 69.5% V5 (many diffs) n/a
6 TRCN0000475231 ACATATGGTCTTCATCTACATTCT pLX_317 28.9% 73% 69.5% V5 (many diffs) n/a
Download CSV