Transcript: Human NM_025159.3

Homo sapiens chromosome X open reading frame 21 (CXorf21), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CXorf21 (80231)
Length:
1792
CDS:
246..1151

Additional Resources:

NCBI RefSeq record:
NM_025159.3
NBCI Gene record:
CXorf21 (80231)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420091 ACATTATGGACACCGTGTTTC pLKO_005 919 CDS 100% 10.800 15.120 N CXorf21 n/a
2 TRCN0000416699 ATAGTCTTTAGCCGCCTATTG pLKO_005 1053 CDS 100% 10.800 15.120 N CXorf21 n/a
3 TRCN0000165215 GCTTCCATTACTGTCTCGCAT pLKO.1 1159 3UTR 100% 2.640 3.696 N CXorf21 n/a
4 TRCN0000162745 CGTCTGAACTCATCATGACAA pLKO.1 967 CDS 100% 4.950 3.960 N CXorf21 n/a
5 TRCN0000161682 GCACTCCTAGTCTCCATATTT pLKO.1 1105 CDS 100% 15.000 10.500 N CXorf21 n/a
6 TRCN0000165850 GCCAGGTGATGGCCATTAATT pLKO.1 640 CDS 100% 15.000 10.500 N CXorf21 n/a
7 TRCN0000160022 CAAATCATCTGGCAAGTTTAT pLKO.1 419 CDS 100% 13.200 9.240 N CXorf21 n/a
8 TRCN0000418677 GCAAATCATCTGGCAAGTTTA pLKO_005 418 CDS 100% 13.200 9.240 N CXorf21 n/a
9 TRCN0000434178 GCAAATGCAGAATCCTATTTC pLKO_005 842 CDS 100% 13.200 9.240 N CXorf21 n/a
10 TRCN0000162649 CCTACTTGGTTCCATCTTCTT pLKO.1 574 CDS 100% 4.950 3.465 N CXorf21 n/a
11 TRCN0000159462 CAAATTCTGTTGCTACCCTTT pLKO.1 349 CDS 100% 4.050 2.835 N CXorf21 n/a
12 TRCN0000165632 GAGCTGCAAATCATCTGGCAA pLKO.1 413 CDS 100% 2.640 1.848 N CXorf21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09021 pDONR223 100% 99.8% 100% None 627T>G n/a
2 ccsbBroad304_09021 pLX_304 0% 99.8% 100% V5 627T>G n/a
3 TRCN0000479436 TGAAGCACCCCTAAAAATAATAAA pLX_317 13.4% 99.8% 100% V5 627T>G n/a
Download CSV