Transcript: Human NM_025182.4

Homo sapiens family with sequence similarity 214 member B (FAM214B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
FAM214B (80256)
Length:
2998
CDS:
278..1894

Additional Resources:

NCBI RefSeq record:
NM_025182.4
NBCI Gene record:
FAM214B (80256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025182.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425466 TCACGCCCAAATGGATTATTT pLKO_005 2013 3UTR 100% 15.000 21.000 N FAM214B n/a
2 TRCN0000130141 CAACCAGACTGTGGTAAAGAT pLKO.1 1579 CDS 100% 5.625 7.875 N FAM214B n/a
3 TRCN0000149736 GCACACACTTGACACTGATTT pLKO.1 826 CDS 100% 13.200 10.560 N FAM214B n/a
4 TRCN0000425480 CCCTCATAATCCACGTTATTC pLKO_005 1861 CDS 100% 13.200 9.240 N FAM214B n/a
5 TRCN0000148088 GCTCCATCTTAGAGAACATAT pLKO.1 1940 3UTR 100% 13.200 9.240 N FAM214B n/a
6 TRCN0000420273 TCTGAACCCATGCGGGCTAAT pLKO_005 1905 3UTR 100% 10.800 7.560 N FAM214B n/a
7 TRCN0000128612 CAAATGCTTCCTGCAATACTT pLKO.1 720 CDS 100% 5.625 3.938 N FAM214B n/a
8 TRCN0000149788 CCATCAAATGCTTCCTGCAAT pLKO.1 716 CDS 100% 4.950 3.465 N FAM214B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025182.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04196 pDONR223 100% 99.9% 100% None 414G>A n/a
2 ccsbBroad304_04196 pLX_304 0% 99.9% 100% V5 414G>A n/a
3 TRCN0000470376 AACCATATATTTGCGACAGCTCGT pLX_317 26.6% 99.9% 100% V5 414G>A n/a
Download CSV