Transcript: Human NM_025227.3

Homo sapiens BPI fold containing family B member 2 (BPIFB2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BPIFB2 (80341)
Length:
1788
CDS:
92..1468

Additional Resources:

NCBI RefSeq record:
NM_025227.3
NBCI Gene record:
BPIFB2 (80341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149374 GCTCAGGCGAATTTCTCATTT pLKO.1 1509 3UTR 100% 13.200 18.480 N BPIFB2 n/a
2 TRCN0000244735 TCGCTGCTCAGGCGAATTTCT pLKO_005 1504 3UTR 100% 5.625 7.875 N BPIFB2 n/a
3 TRCN0000244734 CCTGCTGGCAGCAGCTAATTT pLKO_005 361 CDS 100% 15.000 10.500 N BPIFB2 n/a
4 TRCN0000244732 TCCACCTGGGCACCTTAATTG pLKO_005 648 CDS 100% 13.200 9.240 N BPIFB2 n/a
5 TRCN0000244733 TGAGTCCCAGATCCGCTATTC pLKO_005 688 CDS 100% 10.800 7.560 N BPIFB2 n/a
6 TRCN0000147985 CCTGAAATTCATTGCTGGTTT pLKO.1 331 CDS 100% 4.950 3.465 N BPIFB2 n/a
7 TRCN0000179680 GATCTTTGTCTATGAGGGCTA pLKO.1 1411 CDS 100% 2.160 1.512 N BPIFB2 n/a
8 TRCN0000244731 CAACGTGGGCTTCATTGATAC pLKO_005 1267 CDS 100% 10.800 6.480 N BPIFB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09032 pDONR223 100% 99.8% 99.5% None 770T>G;1361T>A n/a
2 ccsbBroad304_09032 pLX_304 0% 99.8% 99.5% V5 770T>G;1361T>A n/a
3 TRCN0000478539 CCTGGCATCTCTAAGTCCTTGACT pLX_317 22.3% 99.8% 99.5% V5 770T>G;1361T>A n/a
Download CSV