Transcript: Human NM_025260.3

Homo sapiens megakaryocyte and platelet inhibitory receptor G6b (MPIG6B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MPIG6B (80739)
Length:
2435
CDS:
41..754

Additional Resources:

NCBI RefSeq record:
NM_025260.3
NBCI Gene record:
MPIG6B (80739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263692 TTCGACCACTCCCTAGATTTG pLKO_005 561 CDS 100% 10.800 15.120 N MPIG6B n/a
2 TRCN0000122521 CCACATAGCTCCACTTGTGAA pLKO.1 593 CDS 100% 4.950 6.930 N MPIG6B n/a
3 TRCN0000263690 CCACATAGCTCCACTTGTGAA pLKO_005 593 CDS 100% 4.950 6.930 N MPIG6B n/a
4 TRCN0000282761 CTACCCATGGGTCCGTGTATC pLKO_005 441 CDS 100% 3.600 5.040 N MPIG6B n/a
5 TRCN0000122552 CACTCCCTAGATTTGCTCTGT pLKO.1 567 CDS 100% 2.640 3.696 N MPIG6B n/a
6 TRCN0000263691 ACGCTCCCTGGACTCTGGTAT pLKO_005 292 CDS 100% 1.650 1.155 N MPIG6B n/a
7 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 1292 3UTR 100% 10.800 5.400 Y MRPS16 n/a
8 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 1292 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09040 pDONR223 100% 90.9% 90.3% None (many diffs) n/a
2 ccsbBroad304_09040 pLX_304 0% 90.9% 90.3% V5 (many diffs) n/a
3 TRCN0000469958 TCGGTTATCAAGTTAACCCTCTGT pLX_317 59.6% 90.9% 90.3% V5 (many diffs) n/a
Download CSV