Transcript: Mouse NM_025329.3

Mus musculus Tctex1 domain containing 2 (Tctex1d2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tctex1d2 (66061)
Length:
661
CDS:
108..542

Additional Resources:

NCBI RefSeq record:
NM_025329.3
NBCI Gene record:
Tctex1d2 (66061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414974 ACGTCTATCAGAAATGATTAA pLKO_005 326 CDS 100% 13.200 18.480 N Tctex1d2 n/a
2 TRCN0000420269 TTAGACCCTCTGTGGTTAAAG pLKO_005 229 CDS 100% 13.200 18.480 N Tctex1d2 n/a
3 TRCN0000115493 ACGGACAACTACACTCACGAT pLKO.1 462 CDS 100% 2.640 3.696 N Tctex1d2 n/a
4 TRCN0000115494 GAATTGGGATATGACCGGTAT pLKO.1 360 CDS 100% 4.050 3.240 N Tctex1d2 n/a
5 TRCN0000115495 CATTTGGGTGTTTCTACTATT pLKO.1 520 CDS 100% 13.200 9.240 N Tctex1d2 n/a
6 TRCN0000115492 CCTACATTCTGAGGCCCATTT pLKO.1 196 CDS 100% 10.800 7.560 N Tctex1d2 n/a
7 TRCN0000436681 TCTGTGTGGTGGCAGCATTTG pLKO_005 505 CDS 100% 10.800 7.560 N Tctex1d2 n/a
8 TRCN0000115491 CGTTGGGAAGTGTGACTTCAA pLKO.1 545 3UTR 100% 4.950 3.465 N Tctex1d2 n/a
9 TRCN0000143143 CCTCTGTGGTTAAAGACTGTA pLKO.1 235 CDS 100% 4.950 3.465 N TM4SF19 n/a
10 TRCN0000155598 CCTCTGTGGTTAAAGACTGTA pLKO.1 235 CDS 100% 4.950 3.465 N TCTEX1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09909 pDONR223 100% 83.8% 83.3% None (many diffs) n/a
2 ccsbBroad304_09909 pLX_304 0% 83.8% 83.3% V5 (many diffs) n/a
3 TRCN0000471819 GAACAACTGAGTGAAAACAACTCC pLX_317 87.4% 83.8% 83.3% V5 (many diffs) n/a
Download CSV