Transcript: Mouse NM_025424.2

Mus musculus neuron derived neurotrophic factor (Nenf), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Nenf (66208)
Length:
658
CDS:
27..542

Additional Resources:

NCBI RefSeq record:
NM_025424.2
NBCI Gene record:
Nenf (66208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246611 GAGGATCAGCCCATCTACTTG pLKO_005 201 CDS 100% 4.950 6.930 N Nenf n/a
2 TRCN0000246608 GAAGGGAGTGGTGTTCGATGT pLKO_005 227 CDS 100% 4.050 5.670 N Nenf n/a
3 TRCN0000246610 TCTTCAGCAAGGTGTACAAAG pLKO_005 406 CDS 100% 10.800 7.560 N Nenf n/a
4 TRCN0000246612 CAGACCTCACTCACGACACTA pLKO_005 346 CDS 100% 4.950 2.970 N Nenf n/a
5 TRCN0000246609 TGGCCAAGATGTCACTGGATC pLKO_005 322 CDS 100% 4.050 2.430 N Nenf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03112 pDONR223 100% 88.1% 90.6% None (many diffs) n/a
2 ccsbBroad304_03112 pLX_304 0% 88.1% 90.6% V5 (many diffs) n/a
3 TRCN0000477886 ACTCAACCGCTCCGCTATAGCCCC pLX_317 62.5% 88.1% 90.6% V5 (many diffs) n/a
Download CSV