Transcript: Mouse NM_025519.2

Mus musculus charged multivesicular body protein 4C (Chmp4c), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Chmp4c (66371)
Length:
1790
CDS:
60..758

Additional Resources:

NCBI RefSeq record:
NM_025519.2
NBCI Gene record:
Chmp4c (66371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025519.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382430 ACTTGTTCTAGTGAGTCTATG pLKO_005 1184 3UTR 100% 10.800 15.120 N Chmp4c n/a
2 TRCN0000381703 ATACACCATCCCGAGGAATAC pLKO_005 1063 3UTR 100% 10.800 15.120 N Chmp4c n/a
3 TRCN0000105557 TGATGACTTGATGCAAGATAT pLKO.1 443 CDS 100% 13.200 9.240 N Chmp4c n/a
4 TRCN0000437504 ACAAGCCTGGAGCTTCCAAAT pLKO_005 600 CDS 100% 10.800 7.560 N Chmp4c n/a
5 TRCN0000379992 ACACCAACACGGAGGTCTTAC pLKO_005 358 CDS 100% 10.800 7.560 N Chmp4c n/a
6 TRCN0000380272 GATGACTTGATGCAAGATATC pLKO_005 444 CDS 100% 10.800 7.560 N Chmp4c n/a
7 TRCN0000433860 GCAGGACATTGCCCAGGAAAT pLKO_005 473 CDS 100% 10.800 7.560 N Chmp4c n/a
8 TRCN0000414148 GAGTACCTGGAGAACCGAATC pLKO_005 180 CDS 100% 6.000 4.200 N Chmp4c n/a
9 TRCN0000105556 GCAGGAGGAATTAAATAAGAA pLKO.1 575 CDS 100% 5.625 3.938 N Chmp4c n/a
10 TRCN0000105558 CAAAGGGTTCAGTTTGCCGAT pLKO.1 510 CDS 100% 2.160 1.512 N Chmp4c n/a
11 TRCN0000105559 GCTGGAGAACTCGCACACCAA pLKO.1 344 CDS 100% 0.880 0.616 N Chmp4c n/a
12 TRCN0000105555 CCGAAATACCTGAAAGCAGTA pLKO.1 1313 3UTR 100% 4.050 2.430 N Chmp4c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025519.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04581 pDONR223 100% 82.7% 86.6% None (many diffs) n/a
2 ccsbBroad304_04581 pLX_304 0% 82.7% 86.6% V5 (many diffs) n/a
3 TRCN0000466151 GATGTAGCGCAATTCGGCTTTTCA pLX_317 61.6% 82.7% 86.6% V5 (many diffs) n/a
Download CSV