Transcript: Mouse NM_025542.2

Mus musculus replication termination factor 2 (Rtf2), mRNA.

Source:
NCBI, updated 2019-04-14
Taxon:
Mus musculus (mouse)
Gene:
Rtf2 (66404)
Length:
2142
CDS:
94..1017

Additional Resources:

NCBI RefSeq record:
NM_025542.2
NBCI Gene record:
Rtf2 (66404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264798 AGGTCGAGAAGGTTGACAAAG pLKO_005 152 CDS 100% 10.800 15.120 N Rtf2 n/a
2 TRCN0000264796 TCAGAGCTGGCAAGGTTAAAT pLKO_005 1900 3UTR 100% 15.000 10.500 N Rtf2 n/a
3 TRCN0000264797 TGAGCTTGGCAGACTGTATAA pLKO_005 246 CDS 100% 13.200 9.240 N Rtf2 n/a
4 TRCN0000193827 CCGCTATCTTGGTAAGAGAAT pLKO.1 1446 3UTR 100% 4.950 3.465 N Rtf2 n/a
5 TRCN0000215883 CTGAAACCTACAAGTCTATCT pLKO.1 920 CDS 100% 4.950 3.465 N Rtf2 n/a
6 TRCN0000194146 GAGGACATCATTGTGCTCAAT pLKO.1 592 CDS 100% 4.950 3.465 N Rtf2 n/a
7 TRCN0000283181 TCGAGTTTCTGTTGGACAAAT pLKO_005 281 CDS 100% 13.200 7.920 N Rtf2 n/a
8 TRCN0000264795 TCTGAAACCTACAAGTCTATC pLKO_005 919 CDS 100% 10.800 6.480 N Rtf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08302 pDONR223 100% 84.4% 88.2% None (many diffs) n/a
2 ccsbBroad304_08302 pLX_304 0% 84.4% 88.2% V5 (many diffs) n/a
3 TRCN0000472558 TTTCACGACAACCCCGTATTTTAA pLX_317 47.1% 84.4% 88.2% V5 (many diffs) n/a
Download CSV